Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Updating workflows/epigenetics/cutandrun from 0.3 to 0.4 #184

Merged
merged 3 commits into from
Sep 1, 2023
Merged

Updating workflows/epigenetics/cutandrun from 0.3 to 0.4 #184

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
3 commits
Select commit Hold shift + click to select a range
bbfe72e
Updating workflows/epigenetics/cutandrun from 0.3 to 0.4
Mar 17, 2023
19f1117
Updating workflows/epigenetics/cutandrun from 0.4 to 0.5
Jun 17, 2023
52437b6
add normalization option
lldelisle Aug 31, 2023
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
9 changes: 9 additions & 0 deletions workflows/epigenetics/cutandrun/CHANGELOG.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,14 @@
# Changelog

## [0.4] 2023-03-17

### Automatic update
- `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.4`
- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0`

### Manual update
- New parameter to get normalized profile

## [0.3] 2022-12-17

### Automatic update
Expand Down
7 changes: 2 additions & 5 deletions workflows/epigenetics/cutandrun/README.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -9,6 +9,7 @@
- adapter sequences: this depends on the library preparation. Usually CUT&RUN is Truseq and CUT&TAG is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera
- reference_genome: this field will be adapted to the genomes available for bowtie2
- effective_genome_size: this is used by macs2 and may be entered manually (indications are provided for heavily used genomes)
- normalize_profile: Whether you want to have a profile normalized as Signal to Million Reads.

## Processing

Expand All @@ -17,10 +18,6 @@
- The BAM is filtered to keep only MAPQ30 and concordant pairs
- The PCR duplicates are removed with Picard
- The BAM is converted to BED to enable macs2 to take both pairs into account
- The peaks are called with macs2 which at the same time generates a coverage file.
- The peaks are called with macs2 which at the same time generates a coverage file (normalized or not).
- The coverage file is converted to bigwig
- A multiQC is run to have an overview of the QC

### Warning

- The coverage output is not normalized.
2 changes: 2 additions & 0 deletions workflows/epigenetics/cutandrun/cutandrun-tests.yml
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -20,6 +20,7 @@
adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
reference_genome: 'hg38canon'
effective_genome_size: 2700000000
normalize_profile: false
outputs:
Mapping stats:
element_tests:
Expand Down Expand Up @@ -82,6 +83,7 @@
adapter_reverse: 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
reference_genome: 'dm6'
effective_genome_size: 120000000
normalize_profile: true
outputs:
Mapping stats:
element_tests:
Expand Down
Loading