-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #3 from phac-nml/dev
Release 1.0.0
- Loading branch information
Showing
38 changed files
with
745 additions
and
473 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,94 @@ | ||
# phac-nml/viralassembly: Example Commands | ||
A variety of example commands using different parameter options to display how to use each | ||
|
||
## Amplicon | ||
|
||
### Clair3 | ||
Clair3 with a local model, local scheme, fastq directory, conda, and the custom report output | ||
|
||
```bash | ||
nextflow run phac-nml/viralassembly \ | ||
-profile conda \ | ||
--fastq_pass FASTQ_PASS/ \ | ||
--variant_caller 'clair3' \ | ||
--clair3_model ./r1041_e82_400bps_sup_v420 \ | ||
--local_scheme ./primer_schemes \ | ||
--scheme 'hCMV' \ | ||
--scheme_version 'V1' \ | ||
--custom_report \ | ||
--outdir ./results | ||
``` | ||
|
||
### Medaka | ||
Minimal input medaka with conda, an input csv file for data, and the nCoV-2019 scheme | ||
|
||
```bash | ||
nextflow run phac-nml/viralassembly \ | ||
-profile conda \ | ||
--input INPUT.csv \ | ||
--variant_caller 'medaka' \ | ||
--scheme 'nCoV-2019' \ | ||
--scheme_version 'V5.3.2' \ | ||
--outdir ./results | ||
``` | ||
|
||
### Nanopolish | ||
Nanopolish run using singularity and the base artic command line tool (instead of the default nextflow implementation) | ||
|
||
```bash | ||
nextflow run phac-nml/viralassembly \ | ||
-profile singularity \ | ||
--input INPUT.csv \ | ||
--fast5_pass FAST5_PASS/ \ | ||
--sequencing_summart SEQ_SUM.txt \ | ||
--variant_caller 'nanopolish' \ | ||
--scheme 'nCoV-2019' \ | ||
--scheme_version 'V5.3.2' \ | ||
--use_artic_tool \ | ||
--outdir ./results | ||
``` | ||
|
||
-------------------------- | ||
|
||
## Non-Amplicon | ||
|
||
### Clair3 | ||
Minimal clair3 with docker using a fastq input directory along wth a gff3 reference file for SnpEff | ||
|
||
```bash | ||
nextflow run phac-nml/viralassembly \ | ||
-profile docker \ | ||
--fastq_pass FASTQ_PASS/ \ | ||
--variant_caller 'clair3' \ | ||
--reference ./REFERENCE.fa \ | ||
--gff ./REFERENCE.gff | ||
``` | ||
|
||
### Medaka | ||
Medaka with conda skipping QC and SnpEff | ||
|
||
```bash | ||
nextflow run phac-nml/viralassembly \ | ||
-profile conda \ | ||
--input INPUT.csv \ | ||
--variant_caller 'medaka' \ | ||
--reference ./REFERENCE.fa \ | ||
--skip_qc \ | ||
--skip_snpeff | ||
``` | ||
|
||
### Nanopolish | ||
Nanopolish running with conda, filtering the read lengths to be shorter, and creating a custom report | ||
|
||
```bash | ||
nextflow run phac-nml/viralassembly \ | ||
-profile conda \ | ||
--input INPUT.csv \ | ||
--fast5_pass FAST5_PASS/ \ | ||
--sequencing_summart SEQ_SUM.txt \ | ||
--variant_caller 'nanopolish' \ | ||
--reference ./REFERENCE.fa \ | ||
--min_length 100 \ | ||
--max_length 600 \ | ||
--outdir ./results | ||
``` |
9 changes: 9 additions & 0 deletions
9
docs/example_files/inputs/example_custom_scheme/virus/V1-custom/custom.reference.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,9 @@ | ||
>Custom.1 | ||
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT | ||
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT | ||
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC | ||
TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT | ||
CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAAC | ||
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC | ||
TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT | ||
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT |
4 changes: 4 additions & 0 deletions
4
docs/example_files/inputs/example_custom_scheme/virus/V1-custom/custom.scheme.bed
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
Custom.1 10 34 custom_1_LEFT 1 + | ||
Custom.1 300 320 custom_1_RIGHT 1 - | ||
Custom.1 220 246 custom_2_LEFT 2 + | ||
Custom.1 440 460 custom_2_RIGHT 2 - |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,11 @@ | ||
sample,reads | ||
negative-ctrl-1,barcode11 | ||
run-ntc-1,barcode94 | ||
pos-ctrl-1,barcode95 | ||
cov-1,barcode5 | ||
cov-2,barcode01 | ||
cov-3,barcode12 | ||
cov-4,barcode19 | ||
cov-5,barcode40 | ||
cov-6,barcode61 | ||
cov-7,barcode75 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,11 @@ | ||
sample barcode run other | ||
negative-ctrl-1 11 example-run additional_info | ||
run-ntc-1 94 example-run additional_info | ||
pos-ctrl-1 95 example-run additional_info | ||
cov-1 5 example-run additional_info | ||
cov-2 1 example-run additional_info | ||
cov-3 12 example-run additional_info | ||
cov-4 19 example-run additional_info | ||
cov-5 40 example-run additional_info | ||
cov-6 61 example-run additional_info | ||
cov-7 75 example-run additional_info |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Oops, something went wrong.