ruby-libssw

🏁 libssw - fast SIMD parallelized implementation of the Smith-Waterman algorithm - for Ruby

Installation

gem install libssw

Set the environment variable LIBSSWDIR to specify the location of the shared library. For example, on Ubuntu, you can use libssw in the following way.

sudo apt install libssw-dev
export LIBSSWDIR=/usr/lib/x86_64-linux-gnu/ # libssw.so

Installing from source

When installing from source code using the following steps, the shared library libssw.so or libssw.dylib will be packed in the Ruby gem. In this case, the environment variable LIBSSWDIR is not required.

git clone --recursive https://github.com/kojix2/ruby-libssw
bundle exec rake libssw:build
bundle exec rake install

ruby-libssw does not support Windows.

Usage

require 'libssw'

ref_str  = "AAAAAAAAACGTTAAAAAAAAAA"
ref_int  = SSW::DNA.to_int_array(ref_str) 
# [0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 2, 3, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]

read_str1 = "ACGTT"
read_str2 = SSW::DNA.revcomp(read_str1)
# "AACGT"
read_int1 = SSW::DNA.to_int_array(read_str1)
# [0, 1, 2, 3, 3]
read_int2 = SSW::DNA.to_int_array(read_str2)
# [0, 0, 1, 2, 3]

mat = SSW.create_scoring_matrix(SSW::DNA::Elements, 2, -2)
# mat = [2, -2, -2, -2,  0,
#       -2,  2, -2, -2,  0,
#       -2, -2,  2, -2,  0,
#       -2, -2, -2,  2,  0,
#        0,  0,  0,  0,  0]

profile1 = SSW.init(read_int1, mat)
align1   = SSW.align(profile1, ref_int, 3, 1, 1, 0, 0)
pp align1.to_h
# {
#  :score1       => 10,
#  :score2       => 0,
#  :ref_begin1   => 8,
#  :ref_end1     => 12,
#  :read_begin1  => 0,
#  :read_end1    => 4,
#  :ref_end2     => 0,
#  :cigar        => [80],
#  :cigar_len    => 1,
#  :cigar_string => "5M"
# }

profile2 = SSW.init(read_int2, mat)
align2   = SSW.align(profile2, ref_int, 3, 1, 1, 0, 0)
pp align2.to_h
# {
#  :score1       => 10,
#  :score2       => 0,
#  :ref_begin1   => 7,
#  :ref_end1     => 11,
#  :read_begin1  => 0,
#  :read_end1    => 4,
#  :ref_end2     => 0,
#  :cigar        => [80],
#  :cigar_len    => 1,
#  :cigar_string => "5M"
# }

puts SSW.build_path(read_str1, ref_str, align1)
# 5M
# ACGTT
# |||||
# ACGTT

APIs

See API Documentation.

* SSW module
  * SSW.init
  * SSW.init_destroy
  * SSW.align
  * SSW.align_destroy
  * SSW.mark_mismatch
  * SSW.create_scoring_matrix
  * SSW.build_path
  
  * Profile class
    * attributes
      * read, mat, read_len, n, bias

  * Align class
    * attributes
      * score1, score2, ref_begin1, ref_end1, read_begin1, read_end1, ref_end2
        cigar, cigar_len, cigar_string
  
  * DNA module
    * DNA.to_int_array
    * DNA.from_int_array
    * revcomp

  * AASeq module
    * AASeq.to_int_array
    * AASeq.from_int_array

  * BLOSUM62
  * BLOSUM50

Development

git clone --recursive https://github.com/kojix2/ruby-libssw
bundle exec rake libssw:build
bundle exec rake test

Do you need commit rights to my repository?
Do you want to get admin rights and take over the project?
If so, please feel free to contact me @kojix2.

Contributing

• Report bugs
• Fix bugs and submit pull requests
• Write, clarify, or fix documentation
• English corrections are welcome
• Suggest or add new features

License

• MIT License.