Skip to content

kchong89/Tn-seq

 
 

Repository files navigation

Tn-seq

Custom scripts for analyzing (parsing, mapping, and tallying) Tn-seq reads and determining differentially abundant transposon insertion mutants.

Copyright (c) 2014 Keith H. Turner, Jake Everett, Urvish Trivedi, Kendra P. Rumbaugh, and Marvin Whiteley

The scripts contained herein can be used to automatically analyze high-throughput (Illumina) sequencing reads derived from transposon-genome junctions. First, each individual dataset is analyzed with TnSeq.sh or TnSeq2.sh, and then a control and test condition and their specified data files are compared with TnSeqAnalysis.sh. See below for specific usage details and software dependencies. Please direct any questions on their use or construction to Keith H. Turner (khturner at utexas.edu).

TnSeq.sh

This script takes two FASTQ files specifying read 1 and read 2 of a paired-end sequencing run done on a Tn-seq library. This sequencing library should have been prepared with an end-blind method (i.e. the transposon end could be on either read 1 or on read 2), and should contain a "tag" or "IR" sequence derived from the end of the transposon to identify which reads are transposon-derived. These reads are found, trimmed of sequence that will not map to the genome (both transposon- and sequencing adapter-derived), and mapped to your genome with bowtie2. Finally, insertion site locations and read counts are tallied. All results and run information is put in a directory named for your files, and these results can be fed directly into TnSeqAnalysis.sh (see below).

Usage: ./TnSeq.sh [-p <primer seq>] [-i <IR seq>] [-a <assembly>] [-m <#>] <pfx>

Arguments:

<primer seq> - The sequence of your Tn-seq primer specific to your transposon

<IR seq> - The sequence of the transposon end sequence remaining (for junction authentication)

<assembly> - The name of the assembly you're using (e.g. "PAO1")

-m <#> - The number of mismatches/indels you want to tolerate during search

<pfx> - the file prefix for your sequence files (If your sequence files are named condition1_R1.fastq and condition1_R2.fastq, the prefix is "condition1")

Dependencies:

-fqgrep (https://github.com/indraniel/fqgrep)

-bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml)

-$REFGENOME defined in your environment. This should specify a directory that contains bowtie2 references and your genome annotations in GFF format in a subdirectory with the same name as the genome. (e.g. if $REFGENOME is "/home/user/ref_genome", then files such as "/home/user/ref_genome/PAO1/PAO1.gff", "/home/user/ref_genome/PAO1/PAO1.1.bt2", etc. should be present)

-trimmer (this package) should be available through your $PATH

-flexbar (http://sourceforge.net/projects/flexbar/)

-the file "~/adapters/3_adapter_seq.fasta" should specify the Illumina adapters:

>index_sp

AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

>3_adapter_seq

TCGTATGCCGTCTTCTGCTTG

TnSeq2.sh

This script takes one FASTQ file specifying read 1 single-end sequencing run done on a Tn-seq library. This sequencing library should have been prepared with an end-specific method (i.e. the transposon end should be on read 1), and should contain a "tag" or "IR" sequence derived from the end of the transposon to identify which reads are transposon-derived. These reads are found, trimmed of sequence that will not map to the genome (both transposon- and sequencing adapter-derived), and mapped to your genome with bowtie2. Finally, insertion site locations and read counts are tallied. All results and run information is put in a directory named for your files, and these results can be fed directly into TnSeqAnalysis.sh (see below).

Usage: ./TnSeq2.sh [-p <primer seq>] [-i <IR seq>] [-a <assembly>] [-m <#>] <pfx>

Arguments:

<primer seq> - The sequence of your Tn-seq primer specific to your transposon

<IR seq> - The sequence of the transposon end sequence remaining (for junction authentication)

<assembly> - The name of the assembly you're using (e.g. "PAO1")

-m <#> - The number of mismatches/indels you want to tolerate during search

<pfx> - the file prefix for your sequence files (If your sequence file is named condition1_R1.fastq, the prefix is "condition1")

Dependencies:

-fqgrep (https://github.com/indraniel/fqgrep)

-bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml)

-$REFGENOME defined in your environment. This should specify a directory that contains bowtie2 references and your genome annotations in GFF format in a subdirectory with the same name as the genome. (e.g. if $REFGENOME is "/home/user/ref_genome", then files such as "/home/user/ref_genome/PAO1/PAO1.gff", "/home/user/ref_genome/PAO1/PAO1.1.bt2", etc. should be present)

-trimmer (this package) should be available through your $PATH

-flexbar (http://sourceforge.net/projects/flexbar/)

-the file "~/adapters/3_adapter_seq.fasta" should specify the Illumina adapters:

>index_sp

AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

>3_adapter_seq

TCGTATGCCGTCTTCTGCTTG

GFFTrim.pl

This program takes a GFF file on STDIN, trims the specified percentage from the 3' and 5' ends of every feature in that GFF file, and returns a GFF file suffixed ".trunc.gff" with these new starts/ends. This works best with this software package if only features marked as "gene" are present in the GFF file.

Usage: ./GFFTrim.pl (5p) (3p) (genome).gff

Arguments:

(5p) - An integer [0-50] specifying the percentage of the 5' end to trim off of each feature

(3p) - An integer [0-50] specifying the percentage of the 3' end to trim off of each feature

(genome).gff - The GFF file to be trimmed

PullKegg.pl

This program takes a GFF file on STDIN, searches http://www.kegg.jp for the locus_tag and returns a new GFF file with KO and Kegg pathway information on STDOUT. This works best with this software package if only features marked as "gene" are present in the GFF file.

Usage: ./PullKegg.pl < (in).gff > (out.gff)

Dependencies:

-wget (Unix)

TnSeqAnalysis.sh

This script takes the results of TnSeq.sh or TnSeq2.sh for sequence files derived from one or more replicates of two conditions that you wish to compare for differential mutant abundance. The insertion site locations and read counts data is smoothed with LOESS smoothing (to correct for genomic position-dependent effects on apparent insertion abundance), normalized with DESeq, the number of reads per gene and the number of independent insertions identified per gene is tallied, and differential mutant abundance is calculated using a negative binomial test.

Usage: ./TnSeqAnalysis.sh [-i <#>] [-a <assembly>] [-o <output>] [-c <name>] [-x <#>] [-t <name>] [-y <#>] <pfx1> <pfx2> <pfx3> ... <pfxn>

Arguments:

-i <#> - The number of the most represented sites to ignore

<assembly> - The name of the assembly you're using (e.g. "PAO1")

<output> - The name for the output file

-c <name> - The name for the control condition

-x <#> - The number of replicates for the control condition

-t <name> - The name for the test condition

-y <#> - The number of replicates for the test condition

<pfx#> - The file prefixes to be considered, listed with the control conditions followed by the test conditions (e.g. "./TnSeqAnalysis.sh -i 50 -a PAO1 -o Example -c control -x 2 -t test -y 2 C1 C2 T1 T2")

Dependencies:

-$REFGENOME defined in your environment. This should specify a directory that contains your genome annotations in GFF format in a subdirectory with the same name as the genome. (e.g. if $REFGENOME is "/home/user/ref_genome", then the files "/home/user/ref_genome/PAO1/PAO1.trunc.gff" and "/home/user/ref_genome/PAO1/PAO1.gene.products.kegg.txt" should be present)

-R (http://www.r-project.org/)

-Perl (http://www.perl.org/)

-TnSeqDESeq.R (this package) placed in ~/local/bin/ -NOTE: Please have a look inside TnSeqDESeq.R at lines 16-18 and lines 73-83. There are some lines you may want to change to introduce features such as filtering sites based on reliable identification of those sites in replicate samples, or automated annotation of gene names from your GFF file. Please contact Keith Turner (khturner@utexas.edu) with questions.

-TnGeneBin.pl (this package) placed in ~/local/bin/

-DESeq (http://bioconductor.org/packages/release/bioc/html/DESeq.html)

-dplyr (CRAN)

-Optional: (assembly).gene.products.kegg.txt, a tab-separated file containing any annotation information you want automatically appended to your DESeq results file. This is so named because our file includes (locus)-(gene name)-(product)-(KEGG Orthology number)-(KEGG Pathway) information, but you can include whatever you'd like. If you want to change the name of this file, also do so on TnSeqDESeq.R line 69. This file should be in the location described above.

TnSeqEssential.sh

This script takes the results of TnSeq.sh or TnSeq2.sh for sequence files derived from one or more replicates of a single condition that you wish to analyze for significant absence of mutants in all genes in your genome. The insertion site locations and read counts data is smoothed with LOESS smoothing (to correct for genomic position- dependent effects on apparent insertion abundance), and used as the basis for the generation of a number of pseudodatasets that specify an "expected" number of Tn-derived reads per gene, using the null hypothesis that no inserts affect fitness. Real and pseudo-data are normalized with DESeq, the number of reads per gene and the number of independent insertions identified per gene is tallied, and differential mutant abundance is calculated using a negative binomial test.

Usage: ./TnSeqEssential.sh [-i <#>] [-e <#>] [-a <assembly>] [-o <output>] [-c <name>] [-x <#>] <pfx1> <pfx2> <pfx3> ... <pfxn>

Arguments:

-i <#> - The number of the most represented sites to ignore

-e <#> - The number of simulated pseudodatasets you want to generate (warning, this increases execution time exponentially. Try starting with 5 and see how long it takes).

<assembly> - The name of the assembly you're using (e.g. "PAO1")

<output> - The name for the output file

-c <name> - The name for the test condition

-x <#> - The number of replicates for the test condition

<pfx#> - The file prefixes to be considered, listed with the control conditions followed by the test conditions (e.g. "./TnSeqEssential.sh -i 50 -a PAO1 -o Example -c condition -x 2 C1 C2")

Dependencies:

-$REFGENOME defined in your environment. This should specify a directory that contains your genome annotations in GFF format in a subdirectory with the same name as the genome. (e.g. if $REFGENOME is "/home/user/ref_genome", then the files "/home/user/ref_genome/PAO1/PAO1.trunc.gff" and "/home/user/ref_genome/PAO1/PAO1.gene.products.kegg.txt" should be present)

-R (http://www.r-project.org/)

-Perl (http://www.perl.org/)

-TnSeqDESeqEssential.R (this package) placed in ~/local/bin/ -NOTE: Please have a look inside TnSeqDESeq.R at lines 16-18 and lines 85-95. There are some lines you may want to change to introduce features such as filtering sites based on reliable identification of those sites in replicate samples, or automated annotation of gene names from your GFF file. Please contact Keith Turner (khturner@utexas.edu) with questions.

-TnGeneBin.pl (this package) placed in ~/local/bin/

-DESeq (http://bioconductor.org/packages/release/bioc/html/DESeq.html)

-dplyr (CRAN)

-Optional: (assembly).gene.products.kegg.txt, a tab-separated file containing any annotation information you want automatically appended to your DESeq results file. This is so named because our file includes (locus)-(gene name)-(product)-(KEGG Orthology number)-(KEGG Pathway) information, but you can include whatever you'd like. If you want to change the name of this file, also do so on TnSeqDESeq.R line 69. This file should be in the location described above.

About

No description, website, or topics provided.

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published

Languages

  • Shell 41.8%
  • R 31.2%
  • Perl 27.0%