Skip to content

nucleotide-count: Make exercise schema-compliant #666

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
merged 2 commits into from
Mar 9, 2017
Merged
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
90 changes: 49 additions & 41 deletions exercises/nucleotide-count/canonical-data.json
Original file line number Diff line number Diff line change
@@ -1,44 +1,52 @@
{
"nucleotide_counts": {
"description": "count all nucleotides in a strand",
"cases": [
{
"description": "empty strand",
"strand": "",
"expected": {
"A": 0,
"C": 0,
"G": 0,
"T": 0
"exercise": "nucleotide-count",
"version": "1.0.0",
"cases": [
{
"description": "count all nucleotides in a strand",
"cases": [
{
"description": "empty strand",
"property": "nucleotideCounts",
"strand": "",
"expected": {
"A": 0,
"C": 0,
"G": 0,
"T": 0
}
},
{
"description": "strand with repeated nucleotide",
"property": "nucleotideCounts",
"strand": "GGGGGGG",
"expected": {
"A": 0,
"C": 0,
"G": 7,
"T": 0
}
},
{
"description": "strand with multiple nucleotides",
"property": "nucleotideCounts",
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
"expected": {
"A": 20,
"C": 12,
"G": 17,
"T": 21
}
},
{
"description": "strand with invalid nucleotides",
"property": "nucleotideCounts",
"strand": "AGXXACT",
"expected": {
"error": "Invalid nucleotide in strand"
}
}
},
{
"description": "strand with repeated nucleotide",
"strand": "GGGGGGG",
"expected": {
"A": 0,
"C": 0,
"G": 7,
"T": 0
}
},
{
"description": "strand with multiple nucleotides",
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
"expected": {
"A": 20,
"C": 12,
"G": 17,
"T": 21
}
},
{
"description": "strand with invalid nucleotides",
"strand": "AGXXACT",
"expected": {
"error": "Invalid nucleotide in strand"
}
}
]
}
]
}
]
}