The rnamotif program searchs input sequences for portions that match
a given descriptor or "motif". Matching sequences can also be ranked by
various scoring functions. See doc/rnamotif.pdf
for full documentation.
Authors are Tom Macke and David A. Case.
Key literature citations:
-
T. Macke, D. Ecker, R. Gutell, D. Gautheret, D.A. Case and R. Sampath. RNAMotif: A new RNA secondary structure definition and discovery algorithm. Nucl. Acids Res. 29, 4724-4735 (2001).
-
V. Tsui, T. Macke and D.A. Case. A novel method for finding tRNA genes. RNA 9, 507-517 (2003).
==============================================================================
This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2, or (at your option) any later version. The GNU General Public License should be in a file called LICENSE; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.
We thank Dave Ecker and Ranga Sampath for encouragement, and Isis Pharmaceuticals for financial support; Robin Gutell and Daniel Gautheret for suggestions; Vickie Tsui for serving as a beta tester, and for many helpful comments and suggestions.
==============================================================================
-
Edit the "config.h" file in this directory to suit your local environment. This may require no change on many machines, but you may need to locate the C-compiler, lex or yacc, and set compiler flags.
-
Now "make" will make the executables, leaving them in the src subdirectory. There is no "install" target, but (after you run the test suite) you can manually move "rnamotif", "rmfmt", "rm2ct" and "rmprune" to someplace in your PATH if you wish.
-
Set and export the environment variable EFNDATA to point to the efndata subdirectory under this one. Then "make test" will run some test calculations and report results. (Warning: running the tests may take some time.)
Please send comments and questions to Tom Macke macke_tom@yahoo.com.
==============================================================================
- rnamotif can be cloned from github:
https://github.com/dacase/rnamotif
-
This file contains a single top level directory, rnamotif, which contains several subdirectories which in turn contain the sources to rnamotif, three utility programs (rmprune, rmfmt and rm2ct), test data and data required to compute the free energy of the potential secondary structures found by rnamotif.
-
Change directory to where rnamotif was cloned, and edit the configuration file config.h
-
make the binaries:
make
The binaries will left in the subdirectory 'src'. There are four:
- rnamotif The actual serach program.
- rmprune Remove hits that differ only by 'unzipped' base pairs.
- rmfmt Format the output.
- rm2ct Convert the output to ct-format suitable for drawing.
- Test the binaries. One test computes the effective energies of the solutions. To run this, rnamotif must read the files that are in the subdirectory "efndata". Please set this environment symbol EFNDATA to point to the directory rnamotif/efndata and then run the tests:
make test >& test.out &
- This can take up to 20 minutes. This runs rnamotif on 9 descriptors in the subdirectory "test". These descriptors seaerch the database gbrna.111.0.fastn which contains all of the sequences of the (no longer broken out) RNA part of Genbank, release 111, from April 1999.
Generally all tests pass, as indicated by the word PASSED in the file test.out following the lines that run each test. However, the sort command in Red Hat 6.2 (Zoot) behaves differently than other Unixes, or even other versions of Red Hat and sorts the output of the score.1, mp.ends and sprintf tests differently. These tests are not marked as PASSED, but the problem is due to the odd sort, so they do pass.
- (Optional) Move the binaries and/or efndata. Remember that the symbol EFNDATA must point to the directory that contains the energy data in order for rnamotif to compute the dG of the solutions.
rnamotif is run from the command line. It takes two arguments: a descriptor that specifies the 2d strucutre to look for, and a file of fastn data to search for sequences that can adopt that 2d structure. The output is written to stdout. The command
rnamotif -descr test.descr test.fastn
searches the fastn file 'test.fastn' for sequences that can fold up into the 2d structures specified in the descriptor file 'test.descr' If no fastn file is given, rnamotif uses stdin. Note that in the above example, the files have suffixes .descr and .fastn; however, these suffixes are only a convention, as they can have any names.
The full form of the rnamotif command is shown below:
rnamotif [ options ] descr [ seq-file ... ]
options:
-c Compile only, no search
-d Dump internal data structures
-h Dump the strucure hierarchy
-s Show builtin variables
-v Print Version Infomation
-Dvar=expr Set the value of var to expr
-Idir Add include source directory, dir
-xdfname file-name Preprocessor output file
-help Print this message
descr: Use one:
-descr descr-file May have includes; use cmd-line defs
-xdescr xdescr-file May not have includes; ignore cmd-line defs
Many descriptors, (such as a variable length stem that contains a variable length loop) have several solutions that differ only in that the stem has had bases on one or the other or both ends `unzipped'. rmprune takes the output of rnamotif and removes unzipped solutions, leaving only that solution with the longest possible stem.
As an example consider this descriptor:
descr
h5( minlen=4, maxlen=6 ) ss( minlen=4, maxlen=6 ) h3
This descriptor specifies a simple hairpin where the stem must be 4-6 base pairs and the loop 4-6 bases. When rnamotif searches the sequence
aaaaaacccctttttt
it finds 11 possible hairpins:
1 1 14 aaaa aacccc tttt
2 1 15 aaaaa acccc ttttt
3 1 16 aaaaa acccct ttttt 4
4 1 16 aaaaaa cccc tttttt
5 2 13 aaaa acccc tttt
6 2 14 aaaa acccct tttt
7 2 14 aaaaa cccc ttttt
8 2 15 aaaaa cccct ttttt
9 3 12 aaaa cccc tttt
10 3 13 aaaa cccct tttt
11 3 14 aaaa cccctt tttt
Many of these hairpins are merely subsets of the base pairs of the others. rmprune removes these 'unzipped' subsets, leaving 5 unique pairings:
1 1 14 aaaa aacccc tttt
2 1 15 aaaaa acccc ttttt contains 5
4 1 16 aaaaaa cccc tttttt contains 3,6,7,8
8 2 15 aaaaa cccct ttttt contains 10
11 3 14 aaaa cccctt tttt
rmprune is run from the command line and takes an optional argument, a file containing the output of an rnamotif search. If this file is not given, it reads from stdin, allowing it to be placed in a pipeline following rnamotif:
rnamotif -descr hp.descr test.fastn | rmprune
This program is used to format rnamotif output. Two formats are supported.
The first is a viewing option that removes the fastn definition line from the rnamotif output. At the same time sequences that correspond to long fields in the descriptor (ie > 20 bases) are condensed, showing only the 1st 3 and last 3 bases surroungind the total length of the string in parens.
For example the string 'acgtacgtacgtacgtacgtacgt' (len=24) would be replaced by 'acg...(24)...cgt'. The strings are also aligned so that strings that represent ss, h5, p5, t1, t3, q1 and q3 elements are left justified and those that correspond to h3, p3, t2, q2 and q4 fields are right justified. The name of each solution is also simplified, using only the LOCUS name from the fastn definition line. Finally, if at all possible the rnamotif solutions are sorted into descending order based on the value of the score column (#2) placing the best (or worst) solutions at the top. This format option is specified by the -l option.
The second format option is to convert the rnamotif output into a fastn format alignemnt. Justification is as in -l, but the fill characater is the dash (-). Fields are separated by a vertical bar (|). Aligned output is not sorted and the fastn definition lines are retained. This format option is specified by the -a option.
The full rmfmt command is show below:
rmfmt [ -a ] [ -l ] [ -smax N ] [ -td dir ] [ rm-output-file ]
The -smax option sets an upper bound on the size of the file of the output to sort, as this can be impractical for very large output. The default sort limit is 30MB. The -td option allows the user to specify the temp directory that rmfmt places its work files in. These files are needed because the alignment can not be computed until all solutions have been seen. The default temp directory is system dependent and is either /tmp or /var/tmp.
As indicated by the command line, -a and -l can be used together in which case the file is formatted with dashes, unsorted and the names of the sequences are reduced to the last name in the bar separated name section of the fastn definition line.
This program converts the rnamotif output to a ct-format structure file, which can used by various programs to create a graphical representation of the sequence and its 2d structure.
The rm2ct command takes a single optional argument, the name of the file containing the rnamotif output to convert. The output is written to stdout. If no argument is given, rm2ct reads from stdin, allowing it to stand in a pipe:
rnamotif -descr hp.descr test.fastn | rm2ct
ct-format can only represent duplexes, for this reason rm2ct exits with an error message if its input contains triples or quads. However, all dumplexes, including parallel duplexes and pseudoknots are converted, although not it is likely that many ct-format plotting programs can not handle such structures.