multiPrime: version 2.0.3
MultiPrime is a pipeline designed for broad-spectrum detection of target sequences using tNGS. It is implemented in Python and Snakemake and takes a FASTA format file as input. The pipeline has three main steps: classification by identity, primer design, and primer set combination. In the classification step, redundant sequences are removed and clusters are formed by identity. Rare sequence clusters are compared to others by average nucleotide identity, and if they are deemed similar enough, they are merged. In the primer design step, multi-alignment is performed using MUSCLE or MAFFT, and candidate primers are designed using the nearest-neighbor model. Primer pairs are selected based on PCR product length, melting temperature, dimer examination, coverage with errors, and other factors. Finally, a greedy algorithm is used to combine primer pairs into a minimal primer set according to dimer examination.
multiPrime1: Degenerate primer design by DEGEPRIME (MC-DPD).
mulitPrime2: Degenerate primer design by multiPrime-core (MC-EDPD or MC-DPD).
Scripts and pipelines provided in this repository aid to design multiplex PCR primer and return a minimal primerset for multi-PCR. It contains all scripts to allow a self-assembled processing and additionally provides pipeline scripts that run the entire processing automatically.
To run this pipeline, your computer requires 30 GB of available memory (RAM) to process larger number of sequence (e.g. 1,000,000). We don't suggest that Input sequences contains those sequences whose average length is greater than 100K, if necessary, you'd better set the Maxseq in yaml file as small as possible, but do not smaller than 200. Snakemake was used to facilitate the automated execution of all analysis steps. The easiest way to make use of the pipeline is to set up a python 3.9 virtual environment and run the pipeline is this environment.
Download/Provide all necessary files:
DEGEPRIME-1.1.0: DOI: 10.1128/AEM.01403-14; "DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies." Links: https://github.com/EnvGen/DegePrime; please move this directory into scripts.
mfeprimer-3.2.6: DOI: 10.1093/nar/gkz351; Please cite: "MFEprimer-3.0: quality control for PCR primers." please move this it into scripts. Please add "execute" to mfeprimer-3.2.6
biopython: Not required in v1.0.1 and the subsequent version.
MUSCLE: It is already in the requirement.txt. version=v3.8.1551. http://www.drive5.com/muscle This software is donated to the public domain. Please cite: Edgar, R.C. Nucleic Acids Res 32(5), 1792-97.
MAFFT: It is already in the requirement.txt. version=v7.508 (2022/Sep/07). Please cite: "MAFFT multiple sequence alignment software version 7: improvements in performance and usability".
fastANI: It is already in the requirement.txt. version=version 1.33. Please cite: "FastANI, Mash and Dashing equally differentiate between Klebsiella species."
blast+: It is already in the requirement.txt. version=BLAST 2.13.0+. Links: https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastNews.
bowtie2: It is already in the requirement.txt. version=version 2.2.5. DOI:10.1038/nmeth.1923; Please cite: "Fast gapped-read alignment with Bowtie 2." Links: https://www.nature.com/articles/nmeth.1923
Snakemake is a workflow management system that helps to create and execute data processing pipelines. It requires python3 and dependent environment (multiPrime == multiPrime2) can be most easily installed via the bioconda package of the python anaconda distribution.
conda create -n multiPrime -c bioconda -c conda-forge --file requirement.txtif conflict:
conda create -n multiPrime -c bioconda -c conda-forge --file requirement2.txtsource activate multiPrimeTo exit the environment (after finishing the usage of the pipeline), just execute
source deactivateThe working directory contains files named multiPrime.yaml and multiPrime2.yaml. These are the central file in which all user settings, paramter values and path specifications are stored. multiPrime.yaml employs DEGEPRIME-1.1.0 for maximum coverage degenerate primer design (MC-DPD), multiPrime2.yaml use multiPrime-core.py for MC-DPD or MC-DPD with error. During a run, all steps of the pipeline will retrieve their paramter values from these file. It follows the yaml syntax (find more information about yaml and it's syntax here) what makes it easy to read and edit. The main principles are:
- everything that comes after a
#symbol is considered as comment and will not be interpreted - paramters are given as key-value pair, with
keybeing the name andvaluethe value of any paramter
Before starting the pipeline, open the multiPrime.yaml configuration file and set all options according as required. This should at least include:
- name of the input directory - where are your input fasta files stored -input_dir: ["abs_path_to_input_dir"]
- name of the output directory - where should the pipeline store the output files (the direcotry is created if not existing) -results_dir: ["abs_path_to_results_dir"]
- name of the log directory - where should the pipeline store the log files -log_dir: ["abs_path_to_log_dir"]
- name of the scripts directory - where should the pipeline store the scripts files -scripts_dir: ["abs_path_to"]/multiPrime/scripts
- name(s) of your input samples - please note: If your sample is named
sample1.fathensample1will be kept as naming scheme throughout the entire run to indicate output files that belong to this input file, e.g. the pipeline will create a file calledsample1.fa. If you have multiple input files, just follow the given pattern with one sample name per line (and a dash that indicates another list item). - identity - threshold for classification. please note: If you set 1, multiPrime will design candidate primer pairs for each fasta in input files. Suggestion: 0.7-0.8.
Once you set up your configuration file, running the pipeline locally on your computer is as easy as invoking:
sh run.shminimal degeneracy degenerate primer design (MC-DPD):
snakemake --configfile multiPrime.yaml -s multiPrime.py --cores 10 --resources disk_mb=80000minimal degeneracy degenerate primer design with errors (MC-EDPD) or MC-DPD. It depends on the parameter in multiPrime2.yaml. MC-DPD when you set variation=0.
snakemake --configfile multiPrime2.yaml -s multiPrime2.py --cores 10 --resources disk_mb=80000If you want to run python script locally on your computer independently. It is as easy as invoking:
python {path to script}/{target}.py --helpor
python {path to script}/{target}.pyor
pip install multiPrimemultiPrime --helpmultiPrime package contains primer design; primer pair selection and primer pair coverage statistics, more functions will be improved in the future. All manual instruction for multiPrime can be found in here.
For example:
MC-DPD (--variation 0) or MC-EDPD (--variation 1 or 2, we do not suggest you set --variation greater than 2, because amplification efficiency was severely inhibited when there are 3 mismathes).
python scripts/multiPrime-core.pyUsage: multiPrime-core.py -i input -o output -p 20
Options: { -l [18] -n [4] -d [10] -v [1] -e [3.6] -g [0.2,0.7] -f [0.8] -c [4] -p [10] -a [4] }
Options:
-h, --help show this help message and exit
-i INPUT, --input=INPUT
Input file: multi-alignment output (muscle or others).
-l PLEN, --plen=PLEN Length of primer. Default: 18.
-n DNUM, --dnum=DNUM Number of degenerate. Default: 4.
-d DEGENERACY, --degeneracy=DEGENERACY
degeneracy of primer. Default: 10.
-v VARIATION, --variation=VARIATION
Max mismatch number of primer. Default: 1.
-e ENTROPY, --entropy=ENTROPY
Entropy is actually a measure of disorder. This
parameter is used to judge the window is conservation or not.
Entropy of primer-length window. Default: 3.6.
-g GC, --gc=GC Filter primers by GC content. Default [0.2,0.7].
-s SIZE, --size=SIZE Filter primers by mini PRODUCT size. Default 100.
-f FRACTION, --fraction=FRACTION
Filter primers by match fraction. Default: 0.8.
-c COORDINATE, --coordinate=COORDINATE
Mismatch index is not allowed to locate in start or
stop region. otherwise, it won't be regard as the mis-
coverage. With this param, you can control the index
of Y-distance (number and position of mismatch) when calculate
coverage with error.Default: 4.
-p PROC, --proc=PROC Number of process to launch. Default: 20.
-a AWAY, --away=AWAY Filter hairpin structure, which means distance of the
minimal paired bases. Default: 4. Example:(number of
X) AGCT[XXXX]AGCT. Primers should not have
complementary sequences (no consecutive 4 bp
complementarities),otherwise the primers themselves
will fold into hairpin structure.
-o OUT, --out=OUT Output file: candidate primers. e.g.
[*].candidate.primers.txt.Get candidate degenerate primer with high (error) coverage:
python scripts/get_multiPrime.pyUsage: get_multiPrime.py -i input -r sequence.fa -o output
Options: {-f [0.6] -m [500] -n [200] -e [4] -p [9] -s [250,500] -g [0.2,0.7] -d [4] -a ","}.
Options:
-h, --help show this help message and exit
-i INPUT, --input=INPUT
Input file: degeprimer out.
-r REF, --ref=REF Reference sequence file: all the sequence in 1 fasta,
for example: (Cluster_96_171.fa).
-g GC, --gc=GC Filter primers by GC content. Default [0.2,0.7].
-f FRACTION, --fraction=FRACTION
Filter primers by match fraction. Default: 0.6.
Sometimes you need a small fraction to get output.
-e END, --end=END Filter primers by degenerate base position. e.g. [-t
4] means I dont want degenerate base appear at the end
four bases when primer pre-filter. Default: 4.
-p PROC, --proc=PROC Number of process to launch. default: 10.
-s SIZE, --size=SIZE Filter primers by PRODUCT size. Default [250,500].
-d DIST, --dist=DIST Filter param of hairpin, which means distance of the
minimal paired bases. Default: 4. Example:(number of
X) AGCT[XXXX]AGCT.
-a ADAPTOR, --adaptor=ADAPTOR
Adaptor sequence, which is used for NGS next. Hairpin
or dimer detection for [adaptor--primer]. For example:
TCTTTCCCTACACGACGCTCTTCCGATCT,TCTTTCCCTACACGACGCTCTTCCGATCT
(Default). If you dont want adaptor,
use [","]
-m MAXSEQ, --maxseq=MAXSEQ
Limit of sequence number. Default: 500. If 0, then all
sequence will take into account. This param should
consistent with [max_seq] in multi-alignment [muscle].
-o OUT, --out=OUT Output file: candidate primers. e.g.
[*].candidate.primers.txt.Extract primers from ONT reads. FindONTprimerV2.py = FindONTprimerV3.py:
python scripts/FindONTprimerV3.pyUsage: FindONTprimerV3.py -i [input] -s [primer set] -p [20] -l [primer length] -m [0.6] -f [fq] -o [output].
Options:
-h, --help show this help message and exit
-i INPUT, --input=INPUT
Input file: fastq or fasta or fq.gz or fa.gz.
-s SET, --set=SET primer set file.
-p NPROC, --nproc=NPROC
Primer set file. option. Default: 10
-l LEN, --len=LEN Primer length. Default: 18
-m MIN_IDENT, --min_ident=MIN_IDENT
min identity. Default: 0.6
-f FORMAT, --format=FORMAT
Input format can be fasta, fastq, fa.gz and fq.gz. Default: fastq
-o OUT, --out=OUT Output file: candidate primers. e.g.
[*].candidate.primers.txt.Extract PCR products with perfect match:
python scripts/extract_PCR_product.pyUsage: extract_PCR_product.py -i [input] -r [reference] -p [10] -f [format] -o [output]
Options:
--version show program's version number and exit
-h, --help show this help message and exit
-r REF, --ref=REF reference file: template fasta or reference fasta.
-i INPUT, --input=INPUT
Primer file. One of the followed three types:
final_maxprimers_set.xls primer.fa
primer_F,primer_R.
-f FORMAT, --format=FORMAT
Format of primer file: xls or fa or seq; default: xls.
xls: final_primer_set.xls, output of multiPrime. fa:
fasta format. seq: sequence format, comma seperate.
e.g. primer_F,Primer_R.
-o OUT, --out=OUT Output_dir. default: PCR_product.
-p PROCESS, --process=PROCESS
Number of process to launch. default: 10.
-s STAST, --stast=STAST
Stast information: number of coverage and total.
default: Coverage.xls
Get primer information of PCR products with mismatch
python scripts/primer_coverage_validation_by_BWT.pyUsage: primer_coverage_validation_by_BWT.py -i [input] -r [bowtie index] -l [150,2000] -p [10]-o [output]
Options:
-h, --help show this help message and exit
-i INPUT_FILE, --input=INPUT_FILE
input file: primer.fa.
-r REF, --ref=REF reference file: bowtie index.
-l LEN, --len=LEN Length of primer, which is used for mapping. Default:
18
-t TERM, --term=TERM Position of mismatch is not allowed in the 3 term of
primer. Default: 4
-s SIZE, --s=SIZE Length of PCR product, default: 150,2000.
-p PROC, --proc=PROC Number of process. Default: 20
-b BOWTIE, --bowtie=BOWTIE
bowtie or bowtie2 was employed for mapping. Default:
bowtie2
-m SEEDMMS, --seedmms=SEEDMMS
Bowtie: Mismatches in seed (can be 0 - 3, default: -n
1).Bowtie2: Gap or mismatches in seed (can be 0 - 1,
default: -n 1).
-o OUT, --out=OUT Prodcut of PCR product with primers.
Others ...
logs: log file of the multiPrime.py
results: results directory
-cluster.identities: identity of each sequence.
-cluster.txt: cluster information. for example: Cluster_0_222.fa, 0 ==> cluster rank; 222 ==> sequence number.
-history.txt: history of clusters with rare sequence numbers are compared with others by average nucleotide identity.
-Total_fa: genome file and cluster of genome file.
-Clusters_fa: genome file split by each cluster.
--*.fa: fasta of each cluster
--*.tfa: top N {default: 500 randomly selected. Always contain the representative seq} fasta of each cluster
--*.txt: accession id of each cluster
--*.db: directory of database (for bowtie2).
--*.number: number of fasta in each cluster
-Clusters_msa: alginment by muscle
--*.tmsa: muscle output of the top N {default: 500 randomly selected. Always contain the representative seq}
-Clusters_trim_msa: trimmed alignment by degePrimer
--*.trim.tmsa: trimmed muscle by degePrimer
-Clusters_primer: get_degePrimer from degePrimer out
--*.out: paired primers designed by the top N {default: 500} fasta
--*.gap_seq_id_json: Positions and non-contained sequences caused by gap.
--*.non_coverage_seq_id_json: Positions and non-contained sequences caused by others.
-Clusters_cprimer: candidate primers for each cluster.
--*.bed: candidate PCR product (1 mismatch and mismatch position must 4bp away from 3'end at least.)
--*.fa: candidate primers in fa format
--*.txt: candidate primers in txt format (1 line)
--*.Check: tmp file; primers filter by bowtie2 (1 mismatch and mismatch position must 4bp away from 3'end at least.)
-Primers_set:
--candidate_primers_sets.txt: all candidate primers in each cluster
--candidate_primers_sets: directory contain all candidate primers in fasta
--sort.candidate_primers_sets.txt: sorted by the number of candidate primers in each line (cluster)
--final_maxprimers_set.fa: fasta format of primers set for multiPCR
--final_maxprimers_set.xls: primers information of primers set
--final_maxprimers_set.next.xls: primer set 2
--Coverage_stast.xls: coverage of all primers in primer set (perfect match)
--final_maxprimers_set.fa.dimer: dimer check by mfePrimer
--final_maxprimers_set.fa.hairpin: hairpin check by mfePrimer
--PCR_product: perfect PCR product of each primer
-Core_primers_set:
--BWT_coverage: coverage of all primers in core primer set (up to 2-mismatch)
--core_candidate_primers_sets.txt: core candidate primers in each cluster
--core_candidate_primers_sets: directory contain all core candidate primers in fasta
--sort.core_candidate_primers_sets.txt: sorted by the number of core candidate primers in each line (cluster)
--core_final_maxprimers_set.fa: fasta format of core primers set for multiPCR
--core_final_maxprimers_set.xls: primers information of core primers set
--core_final_maxprimers_set.next.xls: primer set 2
--core_Coverage_stast.xls: coverage of all primers in core primer set (perfect match)
--core_candidate_primers_sets.fa: core primer set fasta
--core_candidate_primers_sets.number: candidate primer number of each core cluster
--core_final_maxprimers_set.fa.dimer: dimer check by mfePrimer
--core_final_maxprimers_set.fa.hairpin: hairpin check by mfePrimer
--core_PCR_product: core PCR product of each primer
Please send comments, suggestions, bug reports and bug fixes to 1806389316@pku.edu.cn
This repository is updated frequently. Expect breaking changes. More functions will be improved in the future and a new version is comming.