Skip to content

UludagUniversitesiYazilim/BIO

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

7 Commits
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

BIO

Genetik bilimi açısından önemli veritabanlarından toplu veri alma ve işleme yazılımı.

Desteklenen veritabanları:

  • MutationTaster
  • Polyphen-2
  • ...

Program kendisine verilen büyük veri dosyasındaki bilgilere göre uzak veritabanlarından bilgilere erişir ve okunabilir yapıda kullanıcıya sunar.

Kaynak koddan derlemek için gereksinimler

  • Python v3.0 ve üstü
  • tkinter v8.0 ve üstü
  • requests kütüphanesi (python3 için)
  • BeautifulSoup4 kütüphanesi

Çalıştırılabilir dosya için gereksinimler

  • Yalnızca /build/exe.win-amd64-3.6/main.exe dosyasına çift tıklamanız yeterlı.

Örnek girdi dosyası

Proje içerisinde ./input/input dosyası örnek girdi olarak kullanılabilir.

Girdi dosya yapısı

Her bir kişi için bir satır boşluk bırakılmalı.

name: isim
site: mutationtaster
özellik1: veri
özellik2: veri
... 
...

name: isim
site: polyphen
özellik1: veri
özellik2: veri
özellik3: veri
...

...
...

Eklenebiilecek özellikler

mutationtaster : 
	-> "gene", 
	-> "transcript",
	-> "snippets refers to",
	-> "alteration",
	-> "position",
	-> "new base",
	-> "first wild type base",
	-> "last wild type base",
	-> "inserted bases",
	-> "name of alteration"
	
---------------------------------

polyphen : 
	-> 'protein',
	-> 'sequence',
	-> 'position',
	-> 'AA1', 
	-> 'AA2'

Örnek Girdi dosyası:

to: mutationtaster
name: Hakan Keleş
transcript: ENST00000379370
snippets refers to: gDNA
first wild type base: 28669
last wild type base: 28672

to: polyphen
name: Emre Horsanalı
protein: P41567
position: 59
AA1: L
AA2: P

to: mutationtaster
name: Yetiş Yılmaz
transcript: ENST00000270142
snippets refers to: CDS
alteration: C[A/G]TGTTCATGAGTTTGGAGATAATACAGCAGGCTGT
name of alteration: CHRND_L63P

to: polyphen
name: Hasan Kot
protein: P41567
position: 59
AA1: L
AA2: P

to: polyphen
name: Ahmet Sonuç
protein: P41567
position: 59
AA1: L
AA2: P

to: mutationtaster
name: Berkay Dedeoglu
transcript: ENST00000379370
snippets refers to: gDNA
first wild type base: 28669
last wild type base: 28672

to: polyphen
name: Ismail Can
protein: P41567
position: 59
AA1: L
AA2: P

to: mutationtaster
name: Necla Kayagencer
transcript: ENST00000270142
snippets refers to: CDS
alteration: C[A/G]TGTTCATGAGTTTGGAGATAATACAGCAGGCTGT
name of alteration: CHRND_L63P

to: polyphen
name: Suat Kama
protein: P41567
position: 59
AA1: L
AA2: P

to: polyphen
name: Ahmet Sonuç
protein: P41567
position: 59
AA1: L
AA2: P

to: mutationtaster
name: Ayşegül Yılmaz
gene: KlMn3
transcript: EN2365535896
last wild type base: 12 
inserted bases: 26

to: mutationtaster
name: Ayşegül Yılmaz 
gene: pljh
transcript: EN256321458200
new base: 45
position: 23

to: polyphen
name: İsmail Candaş
protein: EN8965424562
position: 20
AA1: A
AA2: B

Danışman

Dr. Öğr. Üyesi Gıyasettin ÖZCAN


Geliştiriciler

Emre Horsanalı

Berkay Dedeoğlu

About

No description, website, or topics provided.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published