Uncaught OutOfIndexError when a UMapped read is positioned beyond the chromosome's length.

[MaelLefeuvre]

Bug description

Attempting to apply pmd-mask on a file containing reads whose CIGAR exceeds the length specified in the LN field of the corresponding @sq header causes a runtime runtime panic.

Exception first encountered by @J-Sauvage , while applying pmd-mask on sample MX210 ( Furtwangler, 2020)

A description of these "spurious" BAM records can be found in the SAM format specification -page 10:

If POS plus the sum of lengths of M/=/X/D/N operations in CIGAR exceeds the length specified in
the LN field of the @sq header line (if exists) with an SN equal to RNAME, the alignment should
be unmapped, unless the reference sequence is circular (see below)

Minimally reproducible example:

Run pmd-mask on a file containing the following line, with GRCh37 as a reference:

SRR11179329.7101785     4       Y       59373566        37      36M     *       0       0       GGATCACAGGTCTATCACCCTATTAACCACTCACGG    AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ    X0:i:1  X1:i:0  MD:Z:0C35       PG:Z:MarkDuplicates     RG:Z:MX210.sort XG:i:0  NM:i:1  XM:i:1  XN:i:1  XO:i:0  XT:A:U

Note that the expected length of chromosome Y on GRCh37 is exactly 59373566.

Output with TRACE log-level is:

[2023-07-19T16:04:52 TRACE pmd_mask] ---- Inspecting record: Y + 59373565
[2023-07-19T16:04:52 TRACE pmd_mask] Relevant thresholds: (5p: 2bp) (3p: 3bp)
[2023-07-19T16:04:52 TRACE pmd_mask] CIGAR              : 36M
[2023-07-19T16:04:52 TRACE pmd_mask] Reference: N
[2023-07-19T16:04:52 TRACE pmd_mask] Sequence : GGATCACAGGTCTATCACCCTATTAACCACTCACGG
thread 'main' panicked at 'index out of bounds: the len is 1 but the index is 34', /data/mlefeuvre/dev/aDNA-pipeline/workflow/scripts/pmd-mask/src/lib.rs:25:12
note: run with `RUST_BACKTRACE=1` environment variable to display a backtrace
Aborted (core dumped)