Skip to content

Example 1

Jump to bottom
Kinggerm edited this page Mar 1, 2021 · 40 revisions

To take a glimpse of how GetOrganelle works and what the output files look like, in this part, we use GetOrganelle to assemble the Arabidopsis thaliana chloroplast genome from a simulated mini-dataset.

Computational Resource Requirements
System Linux/MacOS
Memory ~600 MB
CPU time ~60 sec

Quickstart

Let's download the reads using wget:

wget https://github.com/Kinggerm/GetOrganelleGallery/raw/master/Test/reads/Arabidopsis_simulated.1.fq.gz
wget https://github.com/Kinggerm/GetOrganelleGallery/raw/master/Test/reads/Arabidopsis_simulated.2.fq.gz
# use gitlab if above connection fails
# wget https://gitlab.com/Kinggerm/GetOrganelleGallery/-/raw/master/Test/reads/Arabidopsis_simulated.1.fq.gz
# wget https://gitlab.com/Kinggerm/GetOrganelleGallery/-/raw/master/Test/reads/Arabidopsis_simulated.2.fq.gz

then check the integrity of downloaded file using md5sum:

md5sum Arabidopsis_simulated.*.fq.gz
# 935589bc609397f1bfc9c40f571f0f19  Arabidopsis_simulated.1.fq.gz
# d0f62eed78d2d2c6bed5f5aeaf4a2c11  Arabidopsis_simulated.2.fq.gz
# Please re-download the reads if md5 values unmatched

then do the plastome assembly:

get_organelle_from_reads.py -1 Arabidopsis_simulated.1.fq.gz -2 Arabidopsis_simulated.2.fq.gz -t 1 -o Arabidopsis_simulated.plastome -F embplant_pt -R 10

# Flag	Value				Illustration
# -1	Arabidopsis_simulated.1.fq.gz	Input file with the forward paired-end reads (*.fq/.gz/.tar.gz)
# -2	Arabidopsis_simulated.2.fq.gz	Input file with the reverse paired-end reads (*.fq/.gz/.tar.gz)
# -t	1				Maximum threads to use. Default: 1
# -o	Arabidopsis_simulated.plastome	Output directory
# -F	embplant_pt			Target organelle genome type(s)
# -R	10				Maximum extension rounds

Running log

After entering the command following the Quickstart, there's nothing else you need to do before it finishes, or crashes abnormally.

Now, you are expected to see the screen information as follows. You don't need (and not recommended) to redirect the screen loggings to a new file using >, because get_organelle_from_reads.py automatically records them to the output directory, in this case, Arabidopsis_simulated.plastome/get_org.log.txt. Let's print the log file by:

cat Arabidopsis_simulated.plastome/get_org.log.txt

GetOrganelle v1.7.0-beta3 # file names changed according to 1.7.4-pre

get_organelle_from_reads.py assembles organelle genomes from genome skimming data.
Find updates in https://github.com/Kinggerm/GetOrganelle and see README.md for more information.

Python 3.6.10 |Anaconda, Inc.| (default, Mar 25 2020, 23:51:54) [GCC 7.3.0]
PYTHON LIBS: numpy 1.18.1; sympy 1.5.1; scipy 1.4.1; psutil 5.7.0
DEPENDENCIES: Bowtie2 2.3.5.1; SPAdes 3.12.0; Blast 2.9.0; Bandage 0.8.1
WORKING DIR: /home/data1
/root/.pyenv/versions/miniconda3-4.3.30/bin/get_organelle_from_reads.py -1 Arabidopsis_simulated.1.fq.gz -2 Arabidopsis_simulated.2.fq.gz -t 1 -o Arabidopsis_simulated.plastome -F embplant_pt -R 10

2020-05-24 20:36:30,994 - INFO: Pre-reading fastq ...
2020-05-24 20:36:30,994 - INFO: Estimating reads to use ... (to use all reads, set '--reduce-reads-for-coverage inf')
2020-05-24 20:36:31,748 - INFO: Estimating reads to use finished.
2020-05-24 20:36:31,748 - INFO: Unzipping reads file: Arabidopsis_simulated.1.fq.gz (8796915 bytes)
2020-05-24 20:36:31,926 - INFO: Unzipping reads file: Arabidopsis_simulated.2.fq.gz (9067061 bytes)
2020-05-24 20:36:32,094 - INFO: Counting read qualities ...
2020-05-24 20:36:32,216 - INFO: Identified quality encoding format = Illumina 1.8+
2020-05-24 20:36:32,218 - INFO: Trimming bases with qualities (0.00%): 33..33 !
2020-05-24 20:36:32,276 - INFO: Mean error rate = 0.0019
2020-05-24 20:36:32,277 - INFO: Counting read lengths ...
2020-05-24 20:36:32,485 - INFO: Mean = 150.0 bp, maximum = 150 bp.
2020-05-24 20:36:32,485 - INFO: Reads used = 91563+91563
2020-05-24 20:36:32,485 - INFO: Pre-reading fastq finished.

2020-05-24 20:36:32,485 - INFO: Making seed reads ...
2020-05-24 20:36:32,486 - INFO: Seed bowtie2 index existed!
2020-05-24 20:36:32,487 - INFO: Mapping reads to seed bowtie2 index ...
2020-05-24 20:36:41,854 - INFO: Mapping finished.
2020-05-24 20:36:41,855 - INFO: Seed reads made: Arabidopsis_simulated.plastome/seed/embplant_pt.initial.fq (14144302 bytes)
2020-05-24 20:36:41,855 - INFO: Making seed reads finished.

2020-05-24 20:36:41,856 - INFO: Checking seed reads and parameters ...
2020-05-24 20:36:41,856 - INFO: The automatically-estimated parameter(s) do not ensure the best choice(s).
2020-05-24 20:36:41,856 - INFO: If the result graph is not a circular organelle genome,
2020-05-24 20:36:41,856 - INFO: you could adjust the value(s) of '-w'/'-R' for another new run.
2020-05-24 20:36:44,801 - INFO: Pre-assembling mapped reads ...
2020-05-24 20:36:50,128 - INFO: Pre-assembling mapped reads finished.
2020-05-24 20:36:50,128 - INFO: Estimated embplant_pt-hitting base-coverage = 38.07
2020-05-24 20:36:50,128 - INFO: Estimated word size(s): 86
2020-05-24 20:36:50,128 - INFO: Setting '-w 86'
2020-05-24 20:36:50,129 - INFO: Setting '--max-extending-len inf'
2020-05-24 20:36:50,200 - INFO: Checking seed reads and parameters finished.

2020-05-24 20:36:50,200 - INFO: Making read index ...
2020-05-24 20:36:51,337 - INFO: Mem 0.284 G, 178623 candidates in all 183126 reads
2020-05-24 20:36:51,338 - INFO: Pre-grouping reads ...
2020-05-24 20:36:51,338 - INFO: Setting '--pre-w 86'
2020-05-24 20:36:51,352 - INFO: Mem 0.284 G, 4074/4074 used/duplicated
2020-05-24 20:36:51,673 - INFO: Mem 0.284 G, 427 groups made.
2020-05-24 20:36:51,683 - INFO: Making read index finished.

2020-05-24 20:36:51,683 - INFO: Extending ...
2020-05-24 20:36:51,683 - INFO: Adding initial words ...
2020-05-24 20:36:53,534 - INFO: AW 1199618
2020-05-24 20:36:55,607 - INFO: Round 1: 178623/178623 AI 40466 AW 1215886 Mem 0.391
2020-05-24 20:36:56,650 - INFO: Round 2: 178623/178623 AI 40485 AW 1216028 Mem 0.391
2020-05-24 20:36:57,698 - INFO: Round 3: 178623/178623 AI 40485 AW 1216028 Mem 0.391
2020-05-24 20:36:57,698 - INFO: No more reads found and terminated ...
2020-05-24 20:36:58,111 - INFO: Extending finished.

2020-05-24 20:36:58,119 - INFO: Separating extended fastq file ...
2020-05-24 20:36:58,237 - INFO: Setting '-k 21,55,85,115'
2020-05-24 20:36:58,237 - INFO: Assembling using SPAdes ...
2020-05-24 20:36:58,245 - INFO: spades.py -t 1 -1 Arabidopsis_simulated.plastome/extended_1_paired.fq -2 Arabidopsis_simulated.plastome/extended_2_paired.fq --s1 Arabidopsis_simulated.plastome/extended_1_unpaired.fq --s2 Arabidopsis_simulated.plastome/extended_2_unpaired.fq -k 21,55,85,115 -o Arabidopsis_simulated.plastome/extended_spades
2020-05-24 20:37:21,710 - INFO: Insert size = 499.355, deviation = 9.90921, left quantile = 487, right quantile = 512
2020-05-24 20:37:21,710 - INFO: Assembling finished.

2020-05-24 20:37:22,807 - INFO: Slimming Arabidopsis_simulated.plastome/extended_spades/K115/assembly_graph.fastg finished!
2020-05-24 20:37:23,859 - INFO: Slimming Arabidopsis_simulated.plastome/extended_spades/K85/assembly_graph.fastg finished!
2020-05-24 20:37:24,883 - INFO: Slimming Arabidopsis_simulated.plastome/extended_spades/K55/assembly_graph.fastg finished!
2020-05-24 20:37:24,883 - INFO: Slimming assembly graphs finished.

2020-05-24 20:37:24,883 - INFO: Extracting embplant_pt from the assemblies ...
2020-05-24 20:37:24,884 - INFO: Disentangling Arabidopsis_simulated.plastome/extended_spades/K115/assembly_graph.fastg.extend-embplant_pt-embplant_mt.fastg as a circular genome ...
2020-05-24 20:37:25,168 - INFO: Vertex_3128 #copy = 1
2020-05-24 20:37:25,169 - INFO: Vertex_3158 #copy = 2
2020-05-24 20:37:25,169 - INFO: Vertex_3160 #copy = 1
2020-05-24 20:37:25,169 - INFO: Average embplant_pt kmer-coverage = 10.2
2020-05-24 20:37:25,169 - INFO: Average embplant_pt base-coverage = 42.4
2020-05-24 20:37:25,169 - INFO: Writing output ...
2020-05-24 20:37:25,216 - WARNING: More than one circular genome structure produced ...
2020-05-24 20:37:25,217 - WARNING: Please check the final result to confirm whether they are simply flip-flop configurations!
2020-05-24 20:37:25,853 - INFO: Detecting large repeats (>1000 bp) in PATH1 with IRs detected, Total:LSC:SSC:Repeat(bp) = 154478:84170:17780:26264
2020-05-24 20:37:25,853 - INFO: Writing PATH1 of complete embplant_pt to Arabidopsis_simulated.plastome/embplant_pt.K115.complete.graph1.1.path_sequence.fasta
2020-05-24 20:37:25,855 - INFO: Writing PATH2 of complete embplant_pt to Arabidopsis_simulated.plastome/embplant_pt.K115.complete.graph1.2.path_sequence.fasta
2020-05-24 20:37:25,855 - INFO: Writing GRAPH to Arabidopsis_simulated.plastome/embplant_pt.K115.complete.graph1.selected_graph.gfa
2020-05-24 20:37:26,025 - INFO: Writing GRAPH image to Arabidopsis_simulated.plastome/embplant_pt.K115.complete.graph1.selected_graph.png
2020-05-24 20:37:26,026 - INFO: Result status of embplant_pt: circular genome
2020-05-24 20:37:26,045 - INFO: Please check the produced assembly image or manually visualize Arabidopsis_simulated.plastome/extended_K115.assembly_graph.fastg.extend-embplant_pt-embplant_mt.fastg using Bandage to confirm the final result.
2020-05-24 20:37:26,045 - INFO: Writing output finished.
2020-05-24 20:37:26,046 - INFO: Extracting embplant_pt from the assemblies finished.


Total cost 55.57 s
Thank you!

Explanations are added to highlighted items where you can put your mouse upon to see.

Output files

You will see the following files in the output directory Arabidopsis_simulated.plastome to be the main output files. In samples with IRs, two isomeric plastome sequences will be generated, differing in the orientation of SSC. These two isomers both exist in the plant (Palmer 1983; JF Walker et al. 2015) and are both usable. In practice, people usually arbitrarily use the one with a commonly-used order (e.g. Arabidopsis thaliana NC_000932.1).

  • embplant_pt.K115.complete.graph1.1.path_sequence.fasta      assembled genome

    >3160-,3158-,3128-,3158+(circular)
    ATGGGCGAACGACGGGAATTGAACCCGCGATGGTGAA ..

  • embplant_pt.K115.complete.graph1.2.path_sequence.fasta      assembled genome

    >3160-,3158-,3128+,3158+(circular)
    ATGGGCGAACGACGGGAATTGAACCCGCGATGGTGAA ..

  • embplant_pt.K115.complete.graph1.selected_graph.gfa      organelle genome assembly graph

    S 3160 CTGTGACACGTTCACTAAAA ..
    S 3158 AATGATCCTCTTTTTTTTTT ..
    S 3128 GATGAATTCCACGTTCGAAC ..
    L 3160 - 3158 - 115M
    L 3160 + 3158 - 115M
    L 3158 - 3128 - 115M
    L 3158 - 3128 + 115M

  • embplant_pt.K115.complete.graph1.selected_graph.png      Bandage-visualized This file will be generated when Bandage was added to the $PATH (optional).
  • get_org.log.txt      the log file
  • extended_K115.assembly_graph.fastg      the original assembly graph file produced by SPAdes
  • extended_K115.assembly_graph.fastg.extend-embplant_pt-embplant_mt.fastg slimmed intermediate assembly graph     
  • extended_K115.assembly_graph.fastg.extend-embplant_pt-embplant_mt.csv     

Besides, you will find lots of temporary files that you can delete them after a successful assembly:

  • seed      subfolder of seed reads and parameter estimation temp files
    • embplant_pt.initial.sam      mapping alignment
    • embplant_pt.initial.fq      seed reads used for read extending
    • embplant_pt.initial.fq.spades      used for parameter estimation, draft assembly
  • extended_1_paired.fq      target organelle associated reads - paired forward
  • extended_1_unpaired.fq      target organelle associated reads - unpaired forward
  • extended_2_paired.fq      target organelle associated reads - paired reverse
  • extended_2_unpaired.fq      target organelle associated reads - unpaired reverse
  • extended_spades      subfolder of SPAdes assemblies
    • scaffolds.paths
    • assembly_graph_with_scaffolds.gfa
    • assembly_graph.fastg
    • spades.log**
    • K115
      • assembly_graph.fastg.extend-embplant_pt-embplant_mt.fastg
      • assembly_graph.fastg.extend-embplant_pt-embplant_mt.csv
      • (other files)
    • K85
      • assembly_graph.fastg.extend-embplant_pt-embplant_mt.fastg
      • assembly_graph.fastg.extend-embplant_pt-embplant_mt.csv
      • (other files)
    • K55
      • assembly_graph.fastg.extend-embplant_pt-embplant_mt.fastg
      • assembly_graph.fastg.extend-embplant_pt-embplant_mt.csv
      • (other files)
    • (other files)      K21, input_dataset.yaml, contigs.fasta, scaffolds.fasta, etc.

Home

Installation

Initialization

Examples

Usage

FAQ

Clone this wiki locally