Skip to content

JbaptisteLam/SpliceAI

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

172 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

SpliceAI: A deep learning-based tool to identify splice variants

release license downloads

This package annotates genetic variants with their predicted effect on splicing, as described in Jaganathan et al, Cell 2019 in press. The annotations for all possible substitutions, 1 base insertions, and 1-4 base deletions within genes are available here for download. These annotations are free for academic and not-for-profit use; other use requires a commercial license from Illumina, Inc.

License

SpliceAI source code is provided under the GPLv3 license. SpliceAI includes several third party packages provided under other open source licenses, please see NOTICE for additional details. The trained models used by SpliceAI (located in this package at spliceai/models) are provided under the CC BY NC 4.0 license for academic and non-commercial use; other use requires a commercial license from Illumina, Inc.

Installation

The simplest way to install SpliceAI is through pip or conda:

pip install spliceai
# or
conda install -c bioconda spliceai

Alternately, SpliceAI can be installed from the github repository:

git clone https://github.com/Illumina/SpliceAI.git
cd SpliceAI
python setup.py install

SpliceAI requires tensorflow>=1.2.0, which is best installed separately via pip or conda (see the TensorFlow website for other installation options):

pip install tensorflow
# or
conda install tensorflow

Usage

SpliceAI can be run from the command line:

spliceai -I input.vcf -O output.vcf -R genome.fa -A grch37
# or you can pipe the input and output VCFs
cat input.vcf | spliceai -R genome.fa -A grch37 > output.vcf

Required parameters:

  • -I: Input VCF with variants of interest.
  • -O: Output VCF with SpliceAI predictions ALLELE|SYMBOL|DS_AG|DS_AL|DS_DG|DS_DL|DP_AG|DP_AL|DP_DG|DP_DL included in the INFO column (see table below for details). Only SNVs and simple INDELs (REF or ALT is a single base) within genes are annotated. Variants in multiple genes have separate predictions for each gene.
  • -R: Reference genome fasta file. Can be downloaded from GRCh37/hg19 or GRCh38/hg38.
  • -A: Gene annotation file. Can instead provide grch37 or grch38 to use GENCODE V24 canonical annotation files included with the package. To create custom gene annotation files, use spliceai/annotations/grch37.txt in repository as template.

Optional parameters:

  • -D: Maximum distance between the variant and gained/lost splice site (default: 50).
  • -M: Mask scores representing annotated acceptor/donor gain and unannotated acceptor/donor loss (default: 0).

Details of SpliceAI INFO field:

ID Description
ALLELE Alternate allele
SYMBOL Gene symbol
DS_AG Delta score (acceptor gain)
DS_AL Delta score (acceptor loss)
DS_DG Delta score (donor gain)
DS_DL Delta score (donor loss)
DP_AG Delta position (acceptor gain)
DP_AL Delta position (acceptor loss)
DP_DG Delta position (donor gain)
DP_DL Delta position (donor loss)

Delta score of a variant, defined as the maximum of (DS_AG, DS_AL, DS_DG, DS_DL), ranges from 0 to 1 and can be interpreted as the probability of the variant being splice-altering. In the paper, a detailed characterization is provided for 0.2 (high recall), 0.5 (recommended), and 0.8 (high precision) cutoffs. Delta position conveys information about the location where splicing changes relative to the variant position (positive values are downstream of the variant, negative values are upstream).

Examples

A sample input file and the corresponding output file can be found at examples/input.vcf and examples/output.vcf respectively. The output T|RYR1|0.00|0.00|0.91|0.08|-28|-46|-2|-31 for the variant 19:38958362 C>T can be interpreted as follows:

  • The probability that the position 19:38958360 (=38958362-2) is used as a splice donor increases by 0.91.
  • The probability that the position 19:38958331 (=38958362-31) is used as a splice donor decreases by 0.08.

Similarly, the output CA|TTN|0.07|1.00|0.00|0.00|-7|-1|35|-29 for the variant 2:179415988 C>CA has the following interpretation:

  • The probability that the position 2:179415981 (=179415988-7) is used as a splice acceptor increases by 0.07.
  • The probability that the position 2:179415987 (=179415988-1) is used as a splice acceptor decreases by 1.00.

Frequently asked questions

1. Why are some variants not scored by SpliceAI?

SpliceAI only annotates variants within genes defined by the gene annotation file. Additionally, SpliceAI does not annotate variants if they are close to chromosome ends (5kb on either side), deletions of length greater than twice the input parameter -D, or inconsistent with the reference fasta file.

2. What are the differences between raw (-M 0) and masked (-M 1) precomputed files?

The raw files also include splicing changes corresponding to strengthening annotated splice sites and weakening unannotated splice sites, which are typically much less pathogenic than weakening annotated splice sites and strengthening unannotated splice sites. The delta scores of such splicing changes are set to 0 in the masked files. We recommend using raw files for alternative splicing analysis and masked files for variant interpretation.

3. Can SpliceAI be used to score custom sequences?

Yes, install SpliceAI and use the following script:

from keras.models import load_model
from pkg_resources import resource_filename
from spliceai.utils import one_hot_encode
import numpy as np

input_sequence = 'CGATCTGACGTGGGTGTCATCGCATTATCGATATTGCAT'
# Replace this with your custom sequence

context = 10000
paths = ('models/spliceai{}.h5'.format(x) for x in range(1, 6))
models = [load_model(resource_filename('spliceai', x)) for x in paths]
x = one_hot_encode('N'*(context//2) + input_sequence + 'N'*(context//2))[None, :]
y = np.mean([models[m].predict(x) for m in range(5)], axis=0)

acceptor_prob = y[0, :, 1]
donor_prob = y[0, :, 2]

Contact

Kishore Jaganathan: kjaganathan@illumina.com

About

A deep learning-based tool to identify splice variants

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors

Languages

  • Python 100.0%