From 43bfe270a81163cb9a135f80f885f8efb67ac7e1 Mon Sep 17 00:00:00 2001 From: Sina Booeshaghi Date: Sat, 28 Jan 2023 14:39:45 -0800 Subject: [PATCH] updated colab link --- examples/seqspec-dev.ipynb | 171 +++++++++++++++++-------------------- 1 file changed, 78 insertions(+), 93 deletions(-) diff --git a/examples/seqspec-dev.ipynb b/examples/seqspec-dev.ipynb index 5be34dc..1503be5 100644 --- a/examples/seqspec-dev.ipynb +++ b/examples/seqspec-dev.ipynb @@ -4,7 +4,7 @@ "metadata": { "colab": { "provenance": [], - "authorship_tag": "ABX9TyOefjW0ytVb+d/LUBmtCNjT", + "authorship_tag": "ABX9TyNvxP9+m8w38LXYpyCqcrUK", "include_colab_link": true }, "kernelspec": { @@ -23,7 +23,7 @@ "colab_type": "text" }, "source": [ - "\"Open" + "\"Open" ] }, { @@ -34,7 +34,7 @@ "colab": { "base_uri": "https://localhost:8080/" }, - "outputId": "2c5906a0-ff6f-4f4b-8616-42262e1c64e3" + "outputId": "5b743958-7f26-45e7-ea97-ba7c50b63a62" }, "outputs": [ { @@ -42,14 +42,13 @@ "name": "stdout", "text": [ "Cloning into 'seqspec'...\n", - "remote: Enumerating objects: 1147, done.\u001b[K\n", - "remote: Counting objects: 100% (385/385), done.\u001b[K\n", - "remote: Compressing objects: 100% (146/146), done.\u001b[K\n", - "remote: Total 1147 (delta 284), reused 284 (delta 225), pack-reused 762\u001b[K\n", - "Receiving objects: 100% (1147/1147), 5.31 MiB | 25.66 MiB/s, done.\n", - "Resolving deltas: 100% (735/735), done.\n", - "\u001b[33m DEPRECATION: A future pip version will change local packages to be built in-place without first copying to a temporary directory. We recommend you use --use-feature=in-tree-build to test your packages with this new behavior before it becomes the default.\n", - " pip 21.3 will remove support for this functionality. You can find discussion regarding this at https://github.com/pypa/pip/issues/7555.\u001b[0m\n", + "remote: Enumerating objects: 1179, done.\u001b[K\n", + "remote: Counting objects: 100% (417/417), done.\u001b[K\n", + "remote: Compressing objects: 100% (175/175), done.\u001b[K\n", + "remote: Total 1179 (delta 300), reused 290 (delta 227), pack-reused 762\u001b[K\n", + "Receiving objects: 100% (1179/1179), 5.32 MiB | 10.30 MiB/s, done.\n", + "Resolving deltas: 100% (751/751), done.\n", + " Preparing metadata (setup.py) ... \u001b[?25l\u001b[?25hdone\n", " Building wheel for seqspec (setup.py) ... \u001b[?25l\u001b[?25hdone\n" ] } @@ -70,7 +69,7 @@ "base_uri": "https://localhost:8080/" }, "id": "TgqvF0qovoxZ", - "outputId": "20d3aea1-4395-44ec-cc7c-cbf5efde1476" + "outputId": "77fef5b6-d9c7-47fc-d120-c6b458e379e9" }, "execution_count": 2, "outputs": [ @@ -117,6 +116,11 @@ " print\n", " seqspec\n", " file\n", + " split\n", + " split\n", + " regions in\n", + " a seqspec\n", + " file\n", "\n", "optional arguments:\n", " -h, --help\n", @@ -138,7 +142,7 @@ "base_uri": "https://localhost:8080/" }, "id": "aGY-aZPsvpQF", - "outputId": "cccd15c0-8778-4237-d886-1c0b26917efd" + "outputId": "5da5252b-4918-423a-97da-5bc8d7dd2cae" }, "execution_count": 3, "outputs": [ @@ -170,7 +174,7 @@ "base_uri": "https://localhost:8080/" }, "id": "W3dFyJyAvzvx", - "outputId": "1e62a344-1bfe-4765-b4f9-db3fbb460005" + "outputId": "ffc4ba36-5f40-4eb0-80f4-c14399ec791c" }, "execution_count": 4, "outputs": [ @@ -260,7 +264,7 @@ ], "metadata": { "id": "EqMqtB_uv2OL", - "outputId": "bd1eba06-2013-4b02-85e7-c6d91c926195", + "outputId": "d9b2d758-655e-4787-e4a3-4bf3d95bd67c", "colab": { "base_uri": "https://localhost:8080/" } @@ -286,7 +290,7 @@ "colab": { "base_uri": "https://localhost:8080/" }, - "outputId": "586362a3-92f9-434d-97b0-cae82ac05548" + "outputId": "1eca61e8-416c-4821-d7c0-2f7412af26d4" }, "execution_count": 6, "outputs": [ @@ -307,7 +311,7 @@ ], "metadata": { "id": "qTK_NmaCZwuR", - "outputId": "0055547c-c97e-45dd-b080-751c6d4be88e", + "outputId": "1f649aeb-c3ea-4fde-b27f-bfda6c3b55a0", "colab": { "base_uri": "https://localhost:8080/" } @@ -330,7 +334,7 @@ ], "metadata": { "id": "7QSjMqk6ZX-n", - "outputId": "f4a6fea1-c007-4875-9178-9c96e60e6e10", + "outputId": "6e9f308a-cd68-4ab0-da5b-cf05514c1f0b", "colab": { "base_uri": "https://localhost:8080/" } @@ -465,7 +469,7 @@ ], "metadata": { "id": "cRQBiSVeTrxZ", - "outputId": "31a09e16-7709-45a4-cefd-a886e1a0e5e8", + "outputId": "b047635c-2778-4d51-f34f-e1b93ae116cf", "colab": { "base_uri": "https://localhost:8080/", "height": 631 @@ -540,12 +544,26 @@ }, { "cell_type": "code", - "source": [], + "source": [ + "print(modeA.sequence)" + ], "metadata": { - "id": "OBC7ZopLq1uG" + "id": "OBC7ZopLq1uG", + "outputId": "638a3743-3cb2-481a-94a7-8203cbc069e9", + "colab": { + "base_uri": "https://localhost:8080/" + } }, - "execution_count": 15, - "outputs": [] + "execution_count": 32, + "outputs": [ + { + "output_type": "stream", + "name": "stdout", + "text": [ + "AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG\n" + ] + } + ] }, { "cell_type": "code", @@ -583,12 +601,12 @@ ], "metadata": { "id": "jPBjFvbjdWkj", - "outputId": "3edc0f9d-e323-4749-e92c-6f2340389481", + "outputId": "6401ea54-d0a3-4e3c-fefc-3de840be4ac9", "colab": { "base_uri": "https://localhost:8080/" } }, - "execution_count": 53, + "execution_count": 17, "outputs": [ { "output_type": "execute_result", @@ -598,7 +616,7 @@ ] }, "metadata": {}, - "execution_count": 53 + "execution_count": 17 } ] }, @@ -610,7 +628,7 @@ "metadata": { "id": "EgtuXsvz_cgC" }, - "execution_count": 17, + "execution_count": 18, "outputs": [] }, { @@ -661,7 +679,7 @@ "metadata": { "id": "0OW-rmeAyRTO" }, - "execution_count": 50, + "execution_count": 19, "outputs": [] }, { @@ -672,7 +690,7 @@ "metadata": { "id": "n0jI7Qx4enj1" }, - "execution_count": 54, + "execution_count": 20, "outputs": [] }, { @@ -682,13 +700,13 @@ ], "metadata": { "id": "8QwMfulfeoPb", - "outputId": "d572e1f2-90be-4071-fd90-5375528c169d", + "outputId": "85b92c60-4144-400b-ff79-d4094069decf", "colab": { "base_uri": "https://localhost:8080/", "height": 35 } }, - "execution_count": 56, + "execution_count": 21, "outputs": [ { "output_type": "execute_result", @@ -701,7 +719,7 @@ } }, "metadata": {}, - "execution_count": 56 + "execution_count": 21 } ] }, @@ -712,41 +730,19 @@ ], "metadata": { "id": "bKVIoBn5FenH", - "outputId": "360bcf3a-06f5-44ca-c487-a82dc9821381", + "outputId": "20913393-cada-4230-b5bd-ae864c5780e5", "colab": { "base_uri": "https://localhost:8080/" } }, - "execution_count": 43, + "execution_count": 22, "outputs": [ { "output_type": "stream", "name": "stdout", "text": [ - "@D00456:228:HL73JBCXY:2:1114:13288:75632 1:N:0:0\n", - "CAGCAGCCAGTCGTGC\n", - "+\n", - "GGGGGIIIIIIIIIII\n", - "@D00456:228:HL73JBCXY:2:1216:6647:85709 1:N:0:0\n", - "CAGCTGGAGATACACA\n", - "+\n", - "GGGGGGIGGIGIIGIG\n", - "@D00456:228:HL73JBCXY:2:1206:8492:9636 1:N:0:0\n", - "CAGCTGGTCAGGCCCA\n", - "+\n", - "GGGGGIIIGGIIGIII\n", - "@D00456:228:HL73JBCXY:2:1114:13288:75632 1:N:0:0\n", - "GCAGGAAGTT\n", - "+\n", - "IIIIIGIIII\n", - "@D00456:228:HL73JBCXY:2:1216:6647:85709 1:N:0:0\n", - "GGGGCCCGCA\n", - "+\n", - "GGIGGIIIGG\n", - "@D00456:228:HL73JBCXY:2:1206:8492:9636 1:N:0:0\n", - "TAGTCTATTT\n", - "+\n", - "IIIGGGIIII\n" + "cat: barcode.fastq: No such file or directory\n", + "cat: umi.fastq: No such file or directory\n" ] } ] @@ -758,29 +754,18 @@ ], "metadata": { "id": "IwWaSfzKcydk", - "outputId": "9ad6439d-f050-4135-d9ba-06e0eac797b3", + "outputId": "1ba6958e-a990-4c5b-d609-8feeb33380f5", "colab": { "base_uri": "https://localhost:8080/" } }, - "execution_count": 44, + "execution_count": 23, "outputs": [ { "output_type": "stream", "name": "stdout", "text": [ - "@D00456:228:HL73JBCXY:2:1114:13288:75632 1:N:0:0\n", - "CAGCAGCCAGTCGTGCGCAGGAAGTT\n", - "+\n", - "GGGGGIIIIIIIIIIIIIIIIGIIII\n", - "@D00456:228:HL73JBCXY:2:1216:6647:85709 1:N:0:0\n", - "CAGCTGGAGATACACAGGGGCCCGCA\n", - "+\n", - "GGGGGGIGGIGIIGIGGGIGGIIIGG\n", - "@D00456:228:HL73JBCXY:2:1206:8492:9636 1:N:0:0\n", - "CAGCTGGTCAGGCCCATAGTCTATTT\n", - "+\n", - "GGGGGIIIGGIIGIIIIIIGGGIIII\n" + "cat: cDNA.fastq: No such file or directory\n" ] } ] @@ -798,7 +783,7 @@ "metadata": { "id": "JQo4CvnfUF3d" }, - "execution_count": 20, + "execution_count": 24, "outputs": [] }, { @@ -809,7 +794,7 @@ "metadata": { "id": "OX2-cPX_r37x" }, - "execution_count": 21, + "execution_count": 25, "outputs": [] }, { @@ -822,9 +807,9 @@ "base_uri": "https://localhost:8080/" }, "id": "q23zpYWvytTA", - "outputId": "bf407c19-2c2d-4401-c6da-1931bc81034b" + "outputId": "c2f4a750-feb2-4251-ef92-8f150d17bdc5" }, - "execution_count": 22, + "execution_count": 26, "outputs": [ { "output_type": "execute_result", @@ -836,7 +821,7 @@ ] }, "metadata": {}, - "execution_count": 22 + "execution_count": 26 } ] }, @@ -851,7 +836,7 @@ "metadata": { "id": "xDtjHdz9yzlO" }, - "execution_count": 23, + "execution_count": 27, "outputs": [] }, { @@ -860,7 +845,7 @@ "metadata": { "id": "hQuRlGDf1bW5" }, - "execution_count": 23, + "execution_count": 27, "outputs": [] }, { @@ -880,21 +865,21 @@ "base_uri": "https://localhost:8080/" }, "id": "Ao8f4fhqy-rm", - "outputId": "df92132f-5ca4-40fe-ca2d-4d7a281902ca" + "outputId": "16eec575-fd0a-466d-c935-281dd415ae86" }, - "execution_count": 24, + "execution_count": 28, "outputs": [ { "output_type": "stream", "name": "stdout", "text": [ - "cDNA R1.fastq.gz 0 98 ATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGC\n", - "linker R2.fastq.gz 8 38 GGTACTAGCATCGACTGCGCTAAAACGATG\n", - "linker R2.fastq.gz 46 76 ACTAGCATCGACTGCGCTAAAACGATGTCT\n", "umi R2.fastq.gz 84 94 AGCATCGACT\n", "barcode R2.fastq.gz 0 8 ATGTCTCT\n", "barcode R2.fastq.gz 38 46 TCTCTGGT\n", - "barcode R2.fastq.gz 76 84 CTGGTACT\n" + "barcode R2.fastq.gz 76 84 CTGGTACT\n", + "cDNA R1.fastq.gz 0 98 ATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGC\n", + "linker R2.fastq.gz 8 38 GGTACTAGCATCGACTGCGCTAAAACGATG\n", + "linker R2.fastq.gz 46 76 ACTAGCATCGACTGCGCTAAAACGATGTCT\n" ] } ] @@ -909,24 +894,24 @@ "base_uri": "https://localhost:8080/" }, "id": "eDxekNjX0nHS", - "outputId": "a9b86920-e78b-4366-9317-e9cd633fd3a7" + "outputId": "ad2002f4-4c0f-4c47-ed15-8481bf0afc76" }, - "execution_count": 25, + "execution_count": 29, "outputs": [ { "output_type": "execute_result", "data": { "text/plain": [ "defaultdict(list,\n", - " {'cDNA': ['ATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGC'],\n", + " {'umi': ['AGCATCGACT'],\n", + " 'barcode': ['ATGTCTCT', 'TCTCTGGT', 'CTGGTACT'],\n", + " 'cDNA': ['ATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGCTAAAACGATGTCTCTGGTACTAGCATCGACTGCGC'],\n", " 'linker': ['GGTACTAGCATCGACTGCGCTAAAACGATG',\n", - " 'ACTAGCATCGACTGCGCTAAAACGATGTCT'],\n", - " 'umi': ['AGCATCGACT'],\n", - " 'barcode': ['ATGTCTCT', 'TCTCTGGT', 'CTGGTACT']})" + " 'ACTAGCATCGACTGCGCTAAAACGATGTCT']})" ] }, "metadata": {}, - "execution_count": 25 + "execution_count": 29 } ] }, @@ -943,7 +928,7 @@ "metadata": { "id": "Lvc5rWwW4A3u" }, - "execution_count": 26, + "execution_count": 30, "outputs": [] } ]