bug: vadr annotation erroneous coordinates/matchs for avian coronavirus

[FTouzain]

Thank you for your work.

When I run vadr 1.6.3 on this virus: https://www.ncbi.nlm.nih.gov/nuccore/KY933089 (fasta file)

I obtain nothing in the 'pass' tsv file.
In the 'fail' tsv file, I get this:

>Feature consensus-from_reference_KY933089
435	20317	gene
			gene	1ab
435	12254	CDS
12254	20317
			product	ORF1ab polyprotein
			product	frameshift product
			protein_id	consensus-from_reference_KY933089_1
435	12284	CDS
			product	ORF1a polyprotein
			protein_id	consensus-from_reference_KY933089_2
435	2453	mat_peptide
			product	leader protein p87
			protein_id	consensus-from_reference_KY933089_1
2454	8762	mat_peptide
			product	coronavirus nsp1 [HD1]
			product	hydrophobic domain 1
			protein_id	consensus-from_reference_KY933089_1
8763	9683	mat_peptide
			product	coronavirus nsp2 [3CL-Pro]
			protein_id	consensus-from_reference_KY933089_1
9684	10565	mat_peptide
			product	coronavirus nsp3 [HD2]
			product	hydrophobic domain 2
			protein_id	consensus-from_reference_KY933089_1
10566	10814	mat_peptide
			product	coronavirus nsp4
			protein_id	consensus-from_reference_KY933089_1
10815	11444	mat_peptide
			product	coronavirus nsp5
			protein_id	consensus-from_reference_KY933089_1
11445	11777	mat_peptide
			product	coronavirus nsp6
			protein_id	consensus-from_reference_KY933089_1
11778	12212	mat_peptide
			product	coronavirus nsp7 [GLF]
			product	growth factor-like protein
			protein_id	consensus-from_reference_KY933089_1
12213	12254	mat_peptide
12254	15031
			product	RNA-dependent RNA polymerase
			product	coronavirus nsp9 [RdRp]
			protein_id	consensus-from_reference_KY933089_1
12213	12281	mat_peptide
			product	coronavirus nsp8
			protein_id	consensus-from_reference_KY933089_2
15032	16831	mat_peptide
			product	coronavirus nsp10
			product	metal-binding NTPase/helicase
			protein_id	consensus-from_reference_KY933089_1
16832	18394	mat_peptide
			product	coronavirus nsp11
			protein_id	consensus-from_reference_KY933089_1
18395	19408	mat_peptide
			product	coronavirus nsp12
			protein_id	consensus-from_reference_KY933089_1
19409	20314	mat_peptide
			product	coronavirus nsp13
			protein_id	consensus-from_reference_KY933089_1
20268	23765	gene
			gene	2
20268	23765	misc_feature
			note	similar to spike protein
23765	24462	gene
			gene	3
23765	23938	CDS
			product	3a protein
			protein_id	consensus-from_reference_KY933089_3
23938	24129	CDS
			product	3b protein
			protein_id	consensus-from_reference_KY933089_4
24113	24442	CDS
			product	small virion-associated protein
			protein_id	consensus-from_reference_KY933089_5
24411	25091	gene
			gene	M
24411	25091	CDS
			product	membrane protein
			protein_id	consensus-from_reference_KY933089_6
25455	25897	gene
			gene	5
25455	25652	CDS
			product	5a protein
			protein_id	consensus-from_reference_KY933089_7
25649	25897	CDS
			product	5b protein
			protein_id	consensus-from_reference_KY933089_8
25840	27068	gene
			gene	N
25840	27068	misc_feature
			note	similar to nucleocapsid protein

Additional note(s) to submitter:
ERROR: CDS_HAS_STOP_CODON: (CDS:spike protein) in-frame stop codon exists 5' of stop position predicted by homology to reference [TAA, shifted S:27,M:27]; seq-coords:23736..23738:+; mdl-coords:23827..23829:+; mdl:NC_001451;
ERROR: CDS_HAS_STOP_CODON: (CDS:spike protein) stop codon in protein-based alignment [-]; seq-coords:23736..23738:+; mdl-coords:23827..23829:+; mdl:NC_001451;
ERROR: POSSIBLE_FRAMESHIFT: (CDS:spike protein) possible frameshift in CDS (frame restored before end) [cause:delete,S:20527,M:20625(1); restore:insert,S:20536(1),M:20633; frame:1(3)1; length:260:(9):3229;]; seq-coords:20528..20536:+; mdl-coords:20625..20633:+; mdl:NC_001451;
ERROR: INDEFINITE_ANNOTATION_START: (CDS:spike protein) protein-based alignment does not extend close enough to nucleotide-based alignment 5' endpoint [99>5]; seq-coords:20268..20366:+; mdl-coords:20368..20368:+; mdl:NC_001451;
ERROR: POSSIBLE_FRAMESHIFT: (CDS:nucleocapsid protein) possible frameshift in CDS (frame not restored before end) [cause:delete,S:27056,M:27090(1); frame:1(3); length:1217:(12);]; seq-coords:27057..27068:+; mdl-coords:27090..27102:+; mdl:NC_001451;
ERROR: INDEFINITE_ANNOTATION_END: (CDS:nucleocapsid protein) protein-based alignment does not extend close enough to nucleotide-based alignment 3' endpoint [11>8]; seq-coords:27058..27068:+; mdl-coords:27102..27102:+; mdl:NC_001451;
ERROR: MUTATION_AT_END: (CDS:nucleocapsid protein) expected stop codon could not be identified, first in-frame stop codon exists 3' of predicted stop position [TAA]; seq-coords:27070..27072:+; mdl-coords:27104..27106:+; mdl:NC_001451;
ERROR: UNEXPECTED_LENGTH: (CDS:nucleocapsid protein) length of complete coding (CDS or mat_peptide) feature is not a multiple of 3 [1229]; seq-coords:25840..27068:+; mdl-coords:25873..27102:+; mdl:NC_001451;

One of the problems is this:

15032	16831	mat_peptide
			product	coronavirus nsp10
			product	metal-binding NTPase/helicase
			protein_id	consensus-from_reference_KY933089_1

It point the reference genome I use (KY933089.1), but at these positions, it is not the nsp10 pointed by vadr but the nsp13 (in my case, I focus on the position 15707) as viewed here:
https://www.ncbi.nlm.nih.gov/nuccore/KY933089.1?report=graph
(on this page, nsp10 is located near 11700 12000 positions)

How can vadr report similarities to a genome with coordinates that do not correspond to the reference genome that is mentioned please?
(I need vadr predictions because I use sometimes assemblies, not ref genomes)

Thank you in advance
Fabrice

[nawrockie]

@FTouzain : I'd be happy to look into this, but it would be helpful if you can please provide some more information. If you provide your vadr model file and the v-annotate.pl command you used, I should be able to reproduce your results and look into it further. Or if you tell me what commands you ran to build your model, I can build it myself.

[FTouzain]

@nawrockie Oh yes, I am sorry, I forgot the most important. I use your classical corona model (25/05/2022) with the command:

v-annotate.pl  --mkey corona  --mdir /db/vadr_db/vadr-models-corona/   --glsearch   --split  -f  --cpu 4  consensus_on_KY933089.fasta    out_dir_vadr/

(in the realease note of the model, it is written: vadr-models-55-1.0.2-dev-5: [Apr 2020] for the model part)
I hope I do not forget info, otherwise tell me. Thank you.

[nawrockie]

@FTouzain :
I was able to reproduce the annotation of nsp10 from 15032 to 16831 by
vadr for KY993089.1. The alignment of NC_001451 (the reference model
VADR uses), which has nsp10 at positions 15132..16931
(https://www.ncbi.nlm.nih.gov/nuccore/NC_001451) and KY993089 clearly
shows that vadr's annotation from 15032 to 16831 is correct. This
alignment will be output from v-annotate.pl if you use the '--out_stk'
option. The alignment file name will end with '.NC_001451.align.stk'.
I'm not sure why the alignment graph you provided the link for shows
that nsp10 is between 11700 and 12000, but in KY993089.1 it is clearly
15032..16831 as vadr reports.

I'm attaching a screenshot of blastx output I get for
NC_001451/15132..16931 (fasta below) and KY993089 showing that the
vadr coords are correct.

Also, based on the model file you are using, I think that you must not
be using the latest version of vadr (1.6.4). When I ran vadr 1.6.4
using the latest coronavirus model library v1.3.3
https://ftp.ncbi.nlm.nih.gov/pub/nawrocki/vadr-models/coronaviridae/CURRENT/vadr-models-corona-1.3-3.tar.gz
I found that there were less alerts output from v-annotate.pl for
KY993089 than what you reported. Based on this, I think that upgrading
to the latest versions will give you better results.

[nawrockie]

>NC_001451.1/15132-16931                                                                                                                                                                                                                    
TCTTGTGGCGTTTGTGTAGTTTGTAATAGTCAAACTATACTACGCTGCGGTAATTGTATT                                                                                                                                                                                
CGTAAACCGTTTTTGTGTTGTAAGTGTTGCTATGACCACGTCATGCATACGGACCACAAA                                                                                                                                                                                
AATGTTTTATCTATAAATCCTTATATTTGCTCACAGCTAGGTTGCGGTGAAGCAGATGTT                                                                                                                                                                                
ACTAAATTGTACCTCGGGGGTATGTCGTACTTCTGTGGTAATCATAAACCGAAATTGTCA                                                                                                                                                                                
ATACCGTTAGTATCTAATGGTACTGTTTTTGGAATTTACAGGGCTAATTGTGCTGGTAGT                                                                                                                                                                                
GAAAATGTTGATGATTTTAATCAACTAGCTACTACTAATTGGTCCATTGTCGAACCTTAT                                                                                                                                                                                
ATTTTAGCAAATCGCTGTAGTGATTCATTGAGACGTTTTGCTGCAGAGACAGTAAAAGCC                                                                                                                                                                                
ACAGAAGAATTACATAAGCAACAATTTGCTAGTGCAGAAGTGCGAGAAGTATTCTCAGAT                                                                                                                                                                                
CGTGAATTGATTCTATCATGGGAACCAGGAAAAACCAGGCCGCCATTGAATAGAAATTAT                                                                                                                                                                                
GTTTTCACAGGTTATCACTTTACAAGAACTAGTAAGGTGCAGCTTGGTGATTTTACATTT                                                                                                                                                                                
GAAAAAGGTGAAGGTAAGGATGTTGTCTATTATAAAGCAACGTCTACTGCTAAATTGTCT                                                                                                                                                                                
GTAGGAGACATTTTTGTTTTAACCTCACACAATGTTGTTTCTCTCGTAGCGCCAACATTG                                                                                                                                                                                
TGTCCACAACAAACCTTTTCTAGGTTTGTAAATTTAAGACCTAATGTAATGGTACCTGAA                                                                                                                                                                                
TGTTTTGTAAATAACATTCCACTTTACCATTTAGTAGGTAAACAGAAGCGTACTACAGTA                                                                                                                                                                                
CAAGGTCCTCCTGGCAGTGGTAAATCCCACTTTGCTATAGGCCTTGCAGTATACTTTAGT                                                                                                                                                                                
AGCGCTCGTGTTGTTTTTACTGCATGTTCTCATGCAGCTGTTGATGCTTTATGTGAAAAA                                                                                                                                                                                
GCTTTTAAGTTTCTTAAAGTTGATGATTGCACTCGTATAGTACCCCAAAGGACTACTGTC                                                                                                                                                                                
GATTGCTTCTCAAAATTTAAAGCTAATGACACAGGCAAAAAGTACATTTTTAGTACTATT                                                                                                                                                                                
AATGCCTTGCCGGAAGTTAGTTGTGATATTCTTTTGGTTGACGAGGTTAGTATGTTGACC                                                                                                                                                                                
AATTACGAATTGTCCTTTATTAATGGTAAGATAAATTACCAATATGTTGTGTATGTAGGT                                                                                                                                                                                
GATCCGGCTCAATTACCGGCACCCCGCACTTTACTTAATGGTTCACTTTCTCCAAAGGAT                                                                                                                                                                                
TATAATGTTGTCACAAACCTTATGGTTTGTGTTAAACCTGATATTTTCCTTGCAAAGTGT                                                                                                                                                                                
TATCGTTGTCCTAAGGAAATTGTAGACACTGTGTCTACTCTTGTTTATGATGGAAAGTTT                                                                                                                                                                                
ATTGCAAATAACCCAGAATCACGTGAGTGTTTCAAGGTTATAGTTAATAATGGCAATTCT                                                                                                                                                                                
GATGTAGGACATGAAAGTGGTTCAGCCTACAACACAACACAATTGGAATTTGTGAAAGAC                                                                                                                                                                                
TTTGTTTGTCGCAATAAACAATGGCGGGAAGCAATATTTATTTCACCTTACAATGCTATG                                                                                                                                                                                
AACCAGAGAGCTTACCGTATGCTTGGACTTAATGTTCAAACAGTAGATTCTTCTCAAGGT                                                                                                                                                                                
TCAGAGTATGATTATGTCATCTTCTGTGTTACTGCAGATTCGCAGCATGCACTGAATATT                                                                                                                                                                                
AATAGATTTAATGTGGCGCTTACAAGAGCTAAGCGTGGTATACTAGTTGTCATGCGCCAG                                                                                                                                                                                
CGTGATGAATTGTATTCTGCTCTTAAGTTTACAGAGCTAGATAGTGAAACAAGTCTGCAA 

[nawrockie]

@FTouzain : actually the best way to see that the vadr coords for nsp10 are correct is to run blastx with query of KY933089, then click 'Align two or more sequences' and enter NP_740630.1 as the subject (NP_740630.1 is the nsp10 protein db entry from NC_001451).

blastx server:
https://blast.ncbi.nlm.nih.gov/Blast.cgi?LINK_LOC=blasthome&PAGE_TYPE=BlastSearch&PROGRAM=blastx