diff --git a/.dockstore.yml b/.dockstore.yml
new file mode 100644
index 0000000..0ed3167
--- /dev/null
+++ b/.dockstore.yml
@@ -0,0 +1,7 @@
+version: 1.2
+workflows:
+- name: 'COVID-19-CONSENSUS-CONSTRUCTION'
+  primaryDescriptorPath: /consensus-from-variation.ga
+  subclass: Galaxy
+  testParameterFiles:
+  - /consensus-from-variation-test.yml
diff --git a/CHANGELOG.md b/CHANGELOG.md
new file mode 100644
index 0000000..cd28650
--- /dev/null
+++ b/CHANGELOG.md
@@ -0,0 +1,3 @@
+0.1
+---------
+- Initial version of COVID-19: consensus construction
diff --git a/README.md b/README.md
new file mode 100644
index 0000000..4bd032f
--- /dev/null
+++ b/README.md
@@ -0,0 +1,28 @@
+COVID-19: consensus construction
+--------------------------------
+
+This workflow aims at generating reliable consensus sequences from variant
+calls according to transparent criteria that capture at least some of the
+complexity of variant calling.
+
+It takes a collection of VCFs and a collection of the corresponding
+aligned reads (for the purpose of calculating genome-wide coverage) such as
+produced by any of the four variant calling workflows in
+https://github.com/galaxyproject/iwc/tree/main/workflows/sars-cov-2-variant-calling
+and generates a collection of viral consensus sequences and a multisample FASTA
+of all these sequences.
+
+Each consensus sequence is guaranteed to capture all called, filter-passing
+variants as defined in the VCF of its sample that reach a user-defined
+consensus allele frequency threshold.
+
+Filter-failing variants and variants below a second user-defined minimal
+allele frequency threshold will be ignored.
+
+Genomic positions of filter-passing variants with an allele frequency in
+between the two thresholds will be hard-masked (with N) in the consensus
+sequence of their sample.
+
+Genomic positions with a coverage (calculated from the read alignments input)
+below another user-defined threshold will be hard-masked, too, unless they are
+consensus variant sites.
diff --git a/consensus-from-variation-test.yml b/consensus-from-variation-test.yml
new file mode 100644
index 0000000..5628282
--- /dev/null
+++ b/consensus-from-variation-test.yml
@@ -0,0 +1,23 @@
+- doc: Test consensus building from called variants
+  job:
+    Reference genome:
+      class: File
+      location: 'https://zenodo.org/record/4555735/files/NC_045512.2_reference.fasta?download=1'
+    aligned reads data for depth calculation:
+      class: Collection
+      collection_type: 'list'
+      elements:
+        - identifier: SRR11578257
+          class: File
+          path: test-data/aligned_reads_for_coverage.bam
+    Variant calls:
+      class: Collection
+      collection_type: 'list'
+      elements:
+        - identifier: SRR11578257
+          class: File
+          path: test-data/final_snpeff_annotated_variants.vcf
+  outputs:
+    multisample_consensus_fasta:
+      file: test-data/masked_consensus.fa
+
diff --git a/consensus-from-variation.ga b/consensus-from-variation.ga
new file mode 100644
index 0000000..e3ef4b4
--- /dev/null
+++ b/consensus-from-variation.ga
@@ -0,0 +1,1735 @@
+{
+    "a_galaxy_workflow": "true",
+    "annotation": "Build a consensus sequence from a list of variants. Hard-mask regions with low coverage and sites with called, but filtered variants.\nNote: Sites with called and retained variants are never masked.",
+    "creator": [
+        {
+            "class": "Person",
+            "identifier": "https://orcid.org/0000-0002-9464-6640",
+            "name": "Wolfgang Maier"
+        }
+    ],
+    "format-version": "0.1",
+    "license": "MIT",
+    "name": "COVID-19: consensus construction",
+    "release": "0.1",
+    "steps": {
+        "0": {
+            "annotation": "Collection of VCFs produced by upstream workflows for variation analysis",
+            "content_id": null,
+            "errors": null,
+            "id": 0,
+            "input_connections": {},
+            "inputs": [
+                {
+                    "description": "Collection of VCFs produced by upstream workflows for variation analysis",
+                    "name": "Variant calls"
+                }
+            ],
+            "label": "Variant calls",
+            "name": "Input dataset collection",
+            "outputs": [],
+            "position": {
+                "bottom": 259.140625,
+                "height": 61,
+                "left": 35.5,
+                "right": 235.5,
+                "top": 198.140625,
+                "width": 200,
+                "x": 35.5,
+                "y": 198.140625
+            },
+            "tool_id": null,
+            "tool_state": "{\"optional\": false, \"collection_type\": \"list\"}",
+            "tool_version": null,
+            "type": "data_collection_input",
+            "uuid": "3ff9ccb1-afe3-4e10-a467-d8be7b4d3cc3",
+            "workflow_outputs": []
+        },
+        "1": {
+            "annotation": "Only variant calls with an allele-frequency greater this value will be considered consensus variants.",
+            "content_id": null,
+            "errors": null,
+            "id": 1,
+            "input_connections": {},
+            "inputs": [
+                {
+                    "description": "Only variant calls with an allele-frequency greater this value will be considered consensus variants.",
+                    "name": "min-AF for consensus variant"
+                }
+            ],
+            "label": "min-AF for consensus variant",
+            "name": "Input parameter",
+            "outputs": [],
+            "position": {
+                "bottom": 576,
+                "height": 101,
+                "left": 38.953125,
+                "right": 238.953125,
+                "top": 475,
+                "width": 200,
+                "x": 38.953125,
+                "y": 475
+            },
+            "tool_id": null,
+            "tool_state": "{\"default\": 0.8, \"parameter_type\": \"float\", \"optional\": true}",
+            "tool_version": null,
+            "type": "parameter_input",
+            "uuid": "976dbe0d-3aeb-4a64-ba60-d437510b447e",
+            "workflow_outputs": [
+                {
+                    "label": null,
+                    "output_name": "output",
+                    "uuid": "21f7761c-d461-4cdd-ae36-b623aa493fcc"
+                }
+            ]
+        },
+        "2": {
+            "annotation": "Variant calls with an allele frequency higher than this value, but lower than the AF threshold for consensus variants will be considered questionable and the respective sites be masked (with Ns) in the consensus sequence.",
+            "content_id": null,
+            "errors": null,
+            "id": 2,
+            "input_connections": {},
+            "inputs": [
+                {
+                    "description": "Variant calls with an allele frequency higher than this value, but lower than the AF threshold for consensus variants will be considered questionable and the respective sites be masked (with Ns) in the consensus sequence.",
+                    "name": "min-AF for failed variants"
+                }
+            ],
+            "label": "min-AF for failed variants",
+            "name": "Input parameter",
+            "outputs": [],
+            "position": {
+                "bottom": 806.65625,
+                "height": 101,
+                "left": 42.953125,
+                "right": 242.953125,
+                "top": 705.65625,
+                "width": 200,
+                "x": 42.953125,
+                "y": 705.65625
+            },
+            "tool_id": null,
+            "tool_state": "{\"default\": 0.2, \"parameter_type\": \"float\", \"optional\": true}",
+            "tool_version": null,
+            "type": "parameter_input",
+            "uuid": "4b2b0e11-28f9-4f73-aea8-bea1c87b8125",
+            "workflow_outputs": [
+                {
+                    "label": null,
+                    "output_name": "output",
+                    "uuid": "8d3dfbd4-e177-4be3-9a6f-bb5ff1a0d647"
+                }
+            ]
+        },
+        "3": {
+            "annotation": "Fully processed BAMs as generated by upstream workflows for variation analysis. Note: for ARTIC data, these BAMs should NOT have undergone processing with ivar removereads.",
+            "content_id": null,
+            "errors": null,
+            "id": 3,
+            "input_connections": {},
+            "inputs": [
+                {
+                    "description": "Fully processed BAMs as generated by upstream workflows for variation analysis. Note: for ARTIC data, these BAMs should NOT have undergone processing with ivar removereads.",
+                    "name": "aligned reads data for depth calculation"
+                }
+            ],
+            "label": "aligned reads data for depth calculation",
+            "name": "Input dataset collection",
+            "outputs": [],
+            "position": {
+                "bottom": 450.171875,
+                "height": 101,
+                "left": 686.8125,
+                "right": 886.8125,
+                "top": 349.171875,
+                "width": 200,
+                "x": 686.8125,
+                "y": 349.171875
+            },
+            "tool_id": null,
+            "tool_state": "{\"optional\": false, \"format\": [\"bam\"], \"collection_type\": \"list\"}",
+            "tool_version": null,
+            "type": "data_collection_input",
+            "uuid": "0a618e2e-6f48-4bd5-87ca-c81ba600aa4a",
+            "workflow_outputs": []
+        },
+        "4": {
+            "annotation": "Sites in the viral genome covered by less than this number of reads are considered questionable and will be masked (with Ns) in the consensus sequence independent of whether a variant has been called at them or not.",
+            "content_id": null,
+            "errors": null,
+            "id": 4,
+            "input_connections": {},
+            "inputs": [
+                {
+                    "description": "Sites in the viral genome covered by less than this number of reads are considered questionable and will be masked (with Ns) in the consensus sequence independent of whether a variant has been called at them or not.",
+                    "name": "Depth-threshold for masking"
+                }
+            ],
+            "label": "Depth-threshold for masking",
+            "name": "Input parameter",
+            "outputs": [],
+            "position": {
+                "bottom": 662.84375,
+                "height": 101,
+                "left": 692.75,
+                "right": 892.75,
+                "top": 561.84375,
+                "width": 200,
+                "x": 692.75,
+                "y": 561.84375
+            },
+            "tool_id": null,
+            "tool_state": "{\"default\": 5, \"parameter_type\": \"integer\", \"optional\": true}",
+            "tool_version": null,
+            "type": "parameter_input",
+            "uuid": "32dd196f-bddc-4922-8c9d-b3f471469bbd",
+            "workflow_outputs": [
+                {
+                    "label": null,
+                    "output_name": "output",
+                    "uuid": "d15c4078-6348-496a-aa7b-f4dbf05d6c8d"
+                }
+            ]
+        },
+        "5": {
+            "annotation": "The SARS-CoV-2 reference genome",
+            "content_id": null,
+            "errors": null,
+            "id": 5,
+            "input_connections": {},
+            "inputs": [
+                {
+                    "description": "The SARS-CoV-2 reference genome",
+                    "name": "Reference genome"
+                }
+            ],
+            "label": "Reference genome",
+            "name": "Input dataset",
+            "outputs": [],
+            "position": {
+                "bottom": 142.15625,
+                "height": 81,
+                "left": 1780.3125,
+                "right": 1980.3125,
+                "top": 61.15625,
+                "width": 200,
+                "x": 1780.3125,
+                "y": 61.15625
+            },
+            "tool_id": null,
+            "tool_state": "{\"optional\": false}",
+            "tool_version": null,
+            "type": "data_input",
+            "uuid": "094717fa-d694-4ce9-8753-e12d5802d55a",
+            "workflow_outputs": []
+        },
+        "6": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1",
+            "errors": null,
+            "id": 6,
+            "input_connections": {
+                "components_1|param_type|component_value": {
+                    "id": 1,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compose text parameter value",
+            "outputs": [
+                {
+                    "name": "out1",
+                    "type": "expression.json"
+                }
+            ],
+            "position": {
+                "bottom": 360.34375,
+                "height": 152,
+                "left": 324.296875,
+                "right": 524.296875,
+                "top": 208.34375,
+                "width": 200,
+                "x": 324.296875,
+                "y": 208.34375
+            },
+            "post_job_actions": {
+                "HideDatasetActionout1": {
+                    "action_arguments": {},
+                    "action_type": "HideDatasetAction",
+                    "output_name": "out1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1",
+            "tool_shed_repository": {
+                "changeset_revision": "e188c9826e0f",
+                "name": "compose_text_param",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"((FILTER = 'PASS') | ( na FILTER )) & (AF >= \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \")\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "0.1.1",
+            "type": "tool",
+            "uuid": "1599af82-3e8e-49d8-bafd-1f2ca756ddf8",
+            "workflow_outputs": []
+        },
+        "7": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1",
+            "errors": null,
+            "id": 7,
+            "input_connections": {
+                "components_1|param_type|component_value": {
+                    "id": 2,
+                    "output_name": "output"
+                },
+                "components_3|param_type|component_value": {
+                    "id": 1,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compose text parameter value",
+            "outputs": [
+                {
+                    "name": "out1",
+                    "type": "expression.json"
+                }
+            ],
+            "position": {
+                "bottom": 1002.015625,
+                "height": 222,
+                "left": 309.5,
+                "right": 509.5,
+                "top": 780.015625,
+                "width": 200,
+                "x": 309.5,
+                "y": 780.015625
+            },
+            "post_job_actions": {
+                "HideDatasetActionout1": {
+                    "action_arguments": {},
+                    "action_type": "HideDatasetAction",
+                    "output_name": "out1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1",
+            "tool_shed_repository": {
+                "changeset_revision": "e188c9826e0f",
+                "name": "compose_text_param",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"(AF > \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \") & (AF < \"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"float\", \"__current_case__\": 2, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \")\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "0.1.1",
+            "type": "tool",
+            "uuid": "3c55ae8d-2bdb-4ca7-956f-04b21d26876c",
+            "workflow_outputs": []
+        },
+        "8": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.29.2",
+            "errors": null,
+            "id": 8,
+            "input_connections": {
+                "input_type|input": {
+                    "id": 3,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "bedtools Genome Coverage",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "bedgraph"
+                }
+            ],
+            "position": {
+                "bottom": 489.34375,
+                "height": 132,
+                "left": 986.296875,
+                "right": 1186.296875,
+                "top": 357.34375,
+                "width": 200,
+                "x": 986.296875,
+                "y": 357.34375
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Depth of coverage"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.29.2",
+            "tool_shed_repository": {
+                "changeset_revision": "0a5c785ac6db",
+                "name": "bedtools",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"d\": \"false\", \"dz\": \"false\", \"five\": \"false\", \"input_type\": {\"input_type_select\": \"bam\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"report\": {\"report_select\": \"bg\", \"__current_case__\": 0, \"zero_regions\": \"true\", \"scale\": \"1.0\"}, \"split\": \"true\", \"strand\": \"\", \"three\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "2.29.2",
+            "type": "tool",
+            "uuid": "25d5d908-0d7f-415b-a8f3-560f8963433f",
+            "workflow_outputs": [
+                {
+                    "label": "coverage_depth",
+                    "output_name": "output",
+                    "uuid": "3e4ef540-6026-4d54-8c2a-992c4dcfaa10"
+                }
+            ]
+        },
+        "9": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1",
+            "errors": null,
+            "id": 9,
+            "input_connections": {
+                "components_1|param_type|component_value": {
+                    "id": 4,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compose text parameter value",
+            "outputs": [
+                {
+                    "name": "out1",
+                    "type": "expression.json"
+                }
+            ],
+            "position": {
+                "bottom": 665.84375,
+                "height": 152,
+                "left": 984.8125,
+                "right": 1184.8125,
+                "top": 513.84375,
+                "width": 200,
+                "x": 984.8125,
+                "y": 513.84375
+            },
+            "post_job_actions": {
+                "HideDatasetActionout1": {
+                    "action_arguments": {},
+                    "action_type": "HideDatasetAction",
+                    "output_name": "out1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1",
+            "tool_shed_repository": {
+                "changeset_revision": "e188c9826e0f",
+                "name": "compose_text_param",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c4 < \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "0.1.1",
+            "type": "tool",
+            "uuid": "df5a8d7a-11c9-43b4-9b62-c8144f56515f",
+            "workflow_outputs": []
+        },
+        "10": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1",
+            "errors": null,
+            "id": 10,
+            "input_connections": {
+                "filter_expression|expr": {
+                    "id": 6,
+                    "output_name": "out1"
+                },
+                "input": {
+                    "id": 0,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "SnpSift Filter",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "vcf"
+                }
+            ],
+            "position": {
+                "bottom": 80,
+                "height": 142,
+                "left": 480.78125,
+                "right": 680.78125,
+                "top": -62,
+                "width": 200,
+                "x": 480.78125,
+                "y": -62
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Consensus variants"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1",
+            "tool_shed_repository": {
+                "changeset_revision": "2e497a770bca",
+                "name": "snpsift",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "4.3+t.galaxy1",
+            "type": "tool",
+            "uuid": "4dce3f5b-907a-469c-b6b5-c6c3518a9819",
+            "workflow_outputs": [
+                {
+                    "label": "consensus_variants",
+                    "output_name": "output",
+                    "uuid": "b56ca4ad-e825-4dda-9af8-101a4e29d4f4"
+                }
+            ]
+        },
+        "11": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1",
+            "errors": null,
+            "id": 11,
+            "input_connections": {
+                "filter_expression|expr": {
+                    "id": 6,
+                    "output_name": "out1"
+                },
+                "input": {
+                    "id": 0,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "SnpSift Filter",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "vcf"
+                }
+            ],
+            "position": {
+                "bottom": 753.640625,
+                "height": 162,
+                "left": 335.78125,
+                "right": 535.78125,
+                "top": 591.640625,
+                "width": 200,
+                "x": 335.78125,
+                "y": 591.640625
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Non-consensus variants"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1",
+            "tool_shed_repository": {
+                "changeset_revision": "2e497a770bca",
+                "name": "snpsift",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "4.3+t.galaxy1",
+            "type": "tool",
+            "uuid": "e2c00e39-c3d4-468a-8cac-4251ba238dcc",
+            "workflow_outputs": [
+                {
+                    "label": "non_consensus_variants",
+                    "output_name": "output",
+                    "uuid": "eac0b6d9-0fb4-4e1f-b9fd-c71f908453a1"
+                }
+            ]
+        },
+        "12": {
+            "annotation": "",
+            "content_id": "Filter1",
+            "errors": null,
+            "id": 12,
+            "input_connections": {
+                "cond": {
+                    "id": 9,
+                    "output_name": "out1"
+                },
+                "input": {
+                    "id": 8,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Filter",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 503.34375,
+                "height": 122,
+                "left": 1319.328125,
+                "right": 1519.328125,
+                "top": 381.34375,
+                "width": 200,
+                "x": 1319.328125,
+                "y": 381.34375
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Low-coverage regions"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "Filter1",
+            "tool_state": "{\"cond\": {\"__class__\": \"ConnectedValue\"}, \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.1.1",
+            "type": "tool",
+            "uuid": "3ddeb6ce-82f2-4fd8-adaa-2f19691d8d8c",
+            "workflow_outputs": [
+                {
+                    "label": "low_cov_regions",
+                    "output_name": "out_file1",
+                    "uuid": "3052a0b9-6c01-4e65-9b26-ec872b326770"
+                }
+            ]
+        },
+        "13": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/vcf2tsv/vcf2tsv/1.0.0_rc3+galaxy0",
+            "errors": null,
+            "id": 13,
+            "input_connections": {
+                "input": {
+                    "id": 10,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "VCFtoTab-delimited:",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 251.171875,
+                "height": 152,
+                "left": 657.9375,
+                "right": 857.9375,
+                "top": 99.171875,
+                "width": 200,
+                "x": 657.9375,
+                "y": 99.171875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Called variants table"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/vcf2tsv/vcf2tsv/1.0.0_rc3+galaxy0",
+            "tool_shed_repository": {
+                "changeset_revision": "285060661b45",
+                "name": "vcf2tsv",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"g_option\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"null_filler\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.0_rc3+galaxy0",
+            "type": "tool",
+            "uuid": "0e000238-e20a-426d-a361-a8477a18d119",
+            "workflow_outputs": [
+                {
+                    "label": "called_variants_table",
+                    "output_name": "out_file1",
+                    "uuid": "7de6722b-c7a3-4f1e-b013-48967acd5787"
+                }
+            ]
+        },
+        "14": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1",
+            "errors": null,
+            "id": 14,
+            "input_connections": {
+                "filter_expression|expr": {
+                    "id": 7,
+                    "output_name": "out1"
+                },
+                "input": {
+                    "id": 11,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "SnpSift Filter",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "vcf"
+                }
+            ],
+            "position": {
+                "bottom": 909.34375,
+                "height": 142,
+                "left": 544.171875,
+                "right": 744.171875,
+                "top": 767.34375,
+                "width": 200,
+                "x": 544.171875,
+                "y": 767.34375
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Filter-failed variants"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift_filter/4.3+t.galaxy1",
+            "tool_shed_repository": {
+                "changeset_revision": "2e497a770bca",
+                "name": "snpsift",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"filter_expression\": {\"type\": \"simple\", \"__current_case__\": 0, \"expr\": {\"__class__\": \"ConnectedValue\"}}, \"filtering\": {\"mode\": \"entries\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"inverse\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "4.3+t.galaxy1",
+            "type": "tool",
+            "uuid": "4bf59a98-2f31-4fdb-bb3f-3bed6519a03f",
+            "workflow_outputs": [
+                {
+                    "label": "filter_failed_variants",
+                    "output_name": "output",
+                    "uuid": "1acfb1b4-6f5d-4110-bba5-b56b5924a278"
+                }
+            ]
+        },
+        "15": {
+            "annotation": "",
+            "content_id": "Cut1",
+            "errors": null,
+            "id": 15,
+            "input_connections": {
+                "input": {
+                    "id": 13,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Cut",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 269.15625,
+                "height": 112,
+                "left": 959.265625,
+                "right": 1159.265625,
+                "top": 157.15625,
+                "width": 200,
+                "x": 959.265625,
+                "y": 157.15625
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Called variants - CHROM_POS_REF"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "Cut1",
+            "tool_state": "{\"columnList\": \"c1,c2,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.2",
+            "type": "tool",
+            "uuid": "3c140350-0827-494e-a212-083f89775b93",
+            "workflow_outputs": [
+                {
+                    "label": "chrom_pos_ref_called_variants",
+                    "output_name": "out_file1",
+                    "uuid": "71a52f83-ec77-4661-946c-37440838fe18"
+                }
+            ]
+        },
+        "16": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/vcf2tsv/vcf2tsv/1.0.0_rc3+galaxy0",
+            "errors": null,
+            "id": 16,
+            "input_connections": {
+                "input": {
+                    "id": 14,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "VCFtoTab-delimited:",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 983.984375,
+                "height": 152,
+                "left": 768.640625,
+                "right": 968.640625,
+                "top": 831.984375,
+                "width": 200,
+                "x": 768.640625,
+                "y": 831.984375
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Filter-failed variants table"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/vcf2tsv/vcf2tsv/1.0.0_rc3+galaxy0",
+            "tool_shed_repository": {
+                "changeset_revision": "285060661b45",
+                "name": "vcf2tsv",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"g_option\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"null_filler\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.0_rc3+galaxy0",
+            "type": "tool",
+            "uuid": "b019117b-b282-4e75-ad01-df2081f9ac5a",
+            "workflow_outputs": [
+                {
+                    "label": "failed_variants_table",
+                    "output_name": "out_file1",
+                    "uuid": "77942c66-93fd-4c80-a1eb-d1b993407ef2"
+                }
+            ]
+        },
+        "17": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "errors": null,
+            "id": 17,
+            "input_connections": {
+                "input": {
+                    "id": 15,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compute",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 335.65625,
+                "height": 132,
+                "left": 1253.640625,
+                "right": 1453.640625,
+                "top": 203.65625,
+                "width": 200,
+                "x": 1253.640625,
+                "y": 203.65625
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Called variants - CHROM_POS_REF with 0-based start added"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "tool_shed_repository": {
+                "changeset_revision": "02026300aa45",
+                "name": "column_maker",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"avoid_scientific_notation\": \"false\", \"cond\": \"c2 - 1\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.6",
+            "type": "tool",
+            "uuid": "23fe4d0f-01cd-4c5a-ac03-9e4952ccd927",
+            "workflow_outputs": [
+                {
+                    "label": "chrom_pos_ref_called_variants_with_0_based_start",
+                    "output_name": "out_file1",
+                    "uuid": "7c195566-4748-417e-8d9d-d39e25495354"
+                }
+            ]
+        },
+        "18": {
+            "annotation": "",
+            "content_id": "Cut1",
+            "errors": null,
+            "id": 18,
+            "input_connections": {
+                "input": {
+                    "id": 16,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Cut",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 1136.3125,
+                "height": 112,
+                "left": 970.765625,
+                "right": 1170.765625,
+                "top": 1024.3125,
+                "width": 200,
+                "x": 970.765625,
+                "y": 1024.3125
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Filter-failed variants - CHROM_POS_REF"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "Cut1",
+            "tool_state": "{\"columnList\": \"c1,c2,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.2",
+            "type": "tool",
+            "uuid": "7113ad70-eaf0-4426-b978-a10781e169ab",
+            "workflow_outputs": [
+                {
+                    "label": "chrom_pos_ref_failed_variants",
+                    "output_name": "out_file1",
+                    "uuid": "5a0f1e3c-739f-4898-9f2b-4e1305e8d04e"
+                }
+            ]
+        },
+        "19": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "errors": null,
+            "id": 19,
+            "input_connections": {
+                "input": {
+                    "id": 17,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compute",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 360.65625,
+                "height": 132,
+                "left": 1529.640625,
+                "right": 1729.640625,
+                "top": 228.65625,
+                "width": 200,
+                "x": 1529.640625,
+                "y": 228.65625
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Called variants - CHROM_POS_REF with 0-based start and end added"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "tool_shed_repository": {
+                "changeset_revision": "02026300aa45",
+                "name": "column_maker",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"avoid_scientific_notation\": \"false\", \"cond\": \"c4 + len(c3)\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.6",
+            "type": "tool",
+            "uuid": "15d27987-7e04-4033-b1cd-541aa34dc85a",
+            "workflow_outputs": [
+                {
+                    "label": "chrom_pos_ref_called_variants_with_0_based_start_end",
+                    "output_name": "out_file1",
+                    "uuid": "f4a86943-6dce-4889-8634-a462bdecd61f"
+                }
+            ]
+        },
+        "20": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "errors": null,
+            "id": 20,
+            "input_connections": {
+                "input": {
+                    "id": 18,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compute",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 977.15625,
+                "height": 132,
+                "left": 1066.109375,
+                "right": 1266.109375,
+                "top": 845.15625,
+                "width": 200,
+                "x": 1066.109375,
+                "y": 845.15625
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Filter-failed variants - CHROM_POS_REF with 0-based start added"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "tool_shed_repository": {
+                "changeset_revision": "02026300aa45",
+                "name": "column_maker",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"avoid_scientific_notation\": \"false\", \"cond\": \"c2 - 1\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.6",
+            "type": "tool",
+            "uuid": "376e3a00-2721-4852-a4a7-705645dcbcae",
+            "workflow_outputs": [
+                {
+                    "label": "chrom_pos_ref_failed_variants_with_0_based_start",
+                    "output_name": "out_file1",
+                    "uuid": "31bd6aec-889d-4e0e-8ec0-e5467debcde1"
+                }
+            ]
+        },
+        "21": {
+            "annotation": "",
+            "content_id": "Cut1",
+            "errors": null,
+            "id": 21,
+            "input_connections": {
+                "input": {
+                    "id": 19,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Cut",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 361.328125,
+                "height": 112,
+                "left": 1797.640625,
+                "right": 1997.640625,
+                "top": 249.328125,
+                "width": 200,
+                "x": 1797.640625,
+                "y": 249.328125
+            },
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "interval"
+                    },
+                    "action_type": "ChangeDatatypeAction",
+                    "output_name": "out_file1"
+                },
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Called variant sites"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "Cut1",
+            "tool_state": "{\"columnList\": \"c1,c4,c5\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.2",
+            "type": "tool",
+            "uuid": "ddd4f6d0-ce29-45b4-a6ca-6c0496972c4f",
+            "workflow_outputs": [
+                {
+                    "label": "called_variant_sites",
+                    "output_name": "out_file1",
+                    "uuid": "2e267866-47e0-410b-88b2-aad3d0a31061"
+                }
+            ]
+        },
+        "22": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "errors": null,
+            "id": 22,
+            "input_connections": {
+                "input": {
+                    "id": 20,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compute",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 830.171875,
+                "height": 132,
+                "left": 1222.125,
+                "right": 1422.125,
+                "top": 698.171875,
+                "width": 200,
+                "x": 1222.125,
+                "y": 698.171875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Filter-failed variants - CHROM_POS_REF with 0-based start and end added"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "tool_shed_repository": {
+                "changeset_revision": "02026300aa45",
+                "name": "column_maker",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"avoid_scientific_notation\": \"false\", \"cond\": \"c4 + len(c3)\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.6",
+            "type": "tool",
+            "uuid": "2248715e-6952-4655-b6bc-b53025bb18f2",
+            "workflow_outputs": [
+                {
+                    "label": "chrom_pos_ref_failed_variants_with_0_based_start_end",
+                    "output_name": "out_file1",
+                    "uuid": "5a398876-3956-4dc3-8f97-ab5509ebc796"
+                }
+            ]
+        },
+        "23": {
+            "annotation": "",
+            "content_id": "Cut1",
+            "errors": null,
+            "id": 23,
+            "input_connections": {
+                "input": {
+                    "id": 22,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Cut",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 688.828125,
+                "height": 112,
+                "left": 1338.15625,
+                "right": 1538.15625,
+                "top": 576.828125,
+                "width": 200,
+                "x": 1338.15625,
+                "y": 576.828125
+            },
+            "post_job_actions": {
+                "ChangeDatatypeActionout_file1": {
+                    "action_arguments": {
+                        "newtype": "interval"
+                    },
+                    "action_type": "ChangeDatatypeAction",
+                    "output_name": "out_file1"
+                },
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Filter-failed variant sites"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "Cut1",
+            "tool_state": "{\"columnList\": \"c1,c4,c5\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.2",
+            "type": "tool",
+            "uuid": "7931868d-86c3-4bbd-adb3-a44e4d5f7e37",
+            "workflow_outputs": [
+                {
+                    "label": "failed_variant_sites",
+                    "output_name": "out_file1",
+                    "uuid": "a5d2853d-75d0-4008-8fe7-95a6e5cb9da8"
+                }
+            ]
+        },
+        "24": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/concat/gops_concat_1/1.0.1",
+            "errors": null,
+            "id": 24,
+            "input_connections": {
+                "input1": {
+                    "id": 12,
+                    "output_name": "out_file1"
+                },
+                "input2": {
+                    "id": 23,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Concatenate",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 633.421875,
+                "height": 142,
+                "left": 1574.375,
+                "right": 1774.375,
+                "top": 491.421875,
+                "width": 200,
+                "x": 1574.375,
+                "y": 491.421875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Cocatenated low-coverage regions and filter-failed sites"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/concat/gops_concat_1/1.0.1",
+            "tool_shed_repository": {
+                "changeset_revision": "35a89f8cc96e",
+                "name": "concat",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"sameformat\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.1",
+            "type": "tool",
+            "uuid": "100d6e71-ed07-40d4-a122-586438e37073",
+            "workflow_outputs": [
+                {
+                    "label": "low_cov_regions_plus_filter_failed",
+                    "output_name": "output",
+                    "uuid": "49e00bcf-93e9-4628-9b47-c98c09b55457"
+                }
+            ]
+        },
+        "25": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/merge/gops_merge_1/1.0.0",
+            "errors": null,
+            "id": 25,
+            "input_connections": {
+                "input1": {
+                    "id": 24,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Merge",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 619.671875,
+                "height": 132,
+                "left": 1808.8125,
+                "right": 2008.8125,
+                "top": 487.671875,
+                "width": 200,
+                "x": 1808.8125,
+                "y": 487.671875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Combined low-coverage regions and filter-failed sites"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/merge/gops_merge_1/1.0.0",
+            "tool_shed_repository": {
+                "changeset_revision": "381cd27bf67a",
+                "name": "merge",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"returntype\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.0",
+            "type": "tool",
+            "uuid": "a5ef3b05-4de0-42db-b7c9-ff24eaa602c8",
+            "workflow_outputs": [
+                {
+                    "label": "low_cov_regions_plus_filter_failed_combined",
+                    "output_name": "output",
+                    "uuid": "f8ba47d7-b2ab-4245-9d00-a76a71c6ca67"
+                }
+            ]
+        },
+        "26": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/subtract/gops_subtract_1/1.0.0",
+            "errors": null,
+            "id": 26,
+            "input_connections": {
+                "input1": {
+                    "id": 25,
+                    "output_name": "output"
+                },
+                "input2": {
+                    "id": 21,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Subtract",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 484,
+                "height": 122,
+                "left": 2064.96875,
+                "right": 2264.96875,
+                "top": 362,
+                "width": 200,
+                "x": 2064.96875,
+                "y": 362
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Masking regions"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/subtract/gops_subtract_1/1.0.0",
+            "tool_shed_repository": {
+                "changeset_revision": "0145969324c4",
+                "name": "subtract",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"min\": \"1\", \"returntype\": \"-p\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.0",
+            "type": "tool",
+            "uuid": "2514d7bc-5f2e-4b9e-9d27-2aa6b5a03ccc",
+            "workflow_outputs": [
+                {
+                    "label": "masking_regions",
+                    "output_name": "output",
+                    "uuid": "1363f18c-16fb-46aa-9629-cd61e4fdd73f"
+                }
+            ]
+        },
+        "27": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "errors": null,
+            "id": 27,
+            "input_connections": {
+                "input": {
+                    "id": 26,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Compute",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 651.671875,
+                "height": 112,
+                "left": 2250.328125,
+                "right": 2450.328125,
+                "top": 539.671875,
+                "width": 200,
+                "x": 2250.328125,
+                "y": 539.671875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "Masking regions with 1-based start added"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6",
+            "tool_shed_repository": {
+                "changeset_revision": "02026300aa45",
+                "name": "column_maker",
+                "owner": "devteam",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"avoid_scientific_notation\": \"false\", \"cond\": \"c2+1\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.6",
+            "type": "tool",
+            "uuid": "984db484-eba3-4c7d-877f-1ef68eafca7b",
+            "workflow_outputs": [
+                {
+                    "label": "masking_regions_with_1_based_start",
+                    "output_name": "out_file1",
+                    "uuid": "a25d8a7b-94b5-400c-8042-5d7cc671cc43"
+                }
+            ]
+        },
+        "28": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_maskfastabed/2.29.2",
+            "errors": null,
+            "id": 28,
+            "input_connections": {
+                "fasta": {
+                    "id": 5,
+                    "output_name": "output"
+                },
+                "input": {
+                    "id": 26,
+                    "output_name": "output"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "bedtools MaskFastaBed",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "fasta"
+                }
+            ],
+            "position": {
+                "bottom": 395.671875,
+                "height": 182,
+                "left": 2408.984375,
+                "right": 2608.984375,
+                "top": 213.671875,
+                "width": 200,
+                "x": 2408.984375,
+                "y": 213.671875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Preconsensus masked genome sequence"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_maskfastabed/2.29.2",
+            "tool_shed_repository": {
+                "changeset_revision": "0a5c785ac6db",
+                "name": "bedtools",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"fasta\": {\"__class__\": \"ConnectedValue\"}, \"fullheader\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"mc\": \"N\", \"soft\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "2.29.2",
+            "type": "tool",
+            "uuid": "16fbc377-e392-4ffd-8304-eba55772c218",
+            "workflow_outputs": [
+                {
+                    "label": "masked_preconsensus",
+                    "output_name": "output",
+                    "uuid": "c025ebc2-5f37-4625-8e7b-45e19d12f300"
+                }
+            ]
+        },
+        "29": {
+            "annotation": "",
+            "content_id": "Cut1",
+            "errors": null,
+            "id": 29,
+            "input_connections": {
+                "input": {
+                    "id": 27,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Cut",
+            "outputs": [
+                {
+                    "name": "out_file1",
+                    "type": "tabular"
+                }
+            ],
+            "position": {
+                "bottom": 656.671875,
+                "height": 112,
+                "left": 2491.65625,
+                "right": 2691.65625,
+                "top": 544.671875,
+                "width": 200,
+                "x": 2491.65625,
+                "y": 544.671875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionout_file1": {
+                    "action_arguments": {
+                        "newname": "1-based masking regions"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "out_file1"
+                }
+            },
+            "tool_id": "Cut1",
+            "tool_state": "{\"columnList\": \"c1,c4,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.0.2",
+            "type": "tool",
+            "uuid": "dbb51bfe-b5ff-4f38-bee8-3686e2965ab4",
+            "workflow_outputs": [
+                {
+                    "label": "1_based_masking_regions",
+                    "output_name": "out_file1",
+                    "uuid": "3cc2af05-6299-46a2-b066-3185e5842382"
+                }
+            ]
+        },
+        "30": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_consensus/bcftools_consensus/1.10",
+            "errors": null,
+            "id": 30,
+            "input_connections": {
+                "input_file": {
+                    "id": 10,
+                    "output_name": "output"
+                },
+                "reference_source|fasta_ref": {
+                    "id": 28,
+                    "output_name": "output"
+                },
+                "sec_default|mask": {
+                    "id": 29,
+                    "output_name": "out_file1"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "bcftools consensus",
+            "outputs": [
+                {
+                    "name": "output_file",
+                    "type": "fasta"
+                }
+            ],
+            "position": {
+                "bottom": 369.671875,
+                "height": 172,
+                "left": 2709.328125,
+                "right": 2909.328125,
+                "top": 197.671875,
+                "width": 200,
+                "x": 2709.328125,
+                "y": 197.671875
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput_file": {
+                    "action_arguments": {
+                        "newname": "Consensus sequence with masking"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output_file"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_consensus/bcftools_consensus/1.10",
+            "tool_shed_repository": {
+                "changeset_revision": "e522022137f6",
+                "name": "bcftools_consensus",
+                "owner": "iuc",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"chain\": \"false\", \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"fasta_ref\": {\"__class__\": \"ConnectedValue\"}}, \"rename\": \"true\", \"sec_default\": {\"mask\": {\"__class__\": \"ConnectedValue\"}, \"iupac_codes\": \"false\", \"sample\": \"\", \"select_haplotype\": null}, \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "1.10",
+            "type": "tool",
+            "uuid": "d06e60a2-6ed5-4725-b3ca-599c61da3f91",
+            "workflow_outputs": [
+                {
+                    "label": "consensus",
+                    "output_name": "output_file",
+                    "uuid": "e5c18bd0-24cc-44e5-9360-6d89bf2b6bad"
+                }
+            ]
+        },
+        "31": {
+            "annotation": "",
+            "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/4.2",
+            "errors": null,
+            "id": 31,
+            "input_connections": {
+                "input_list": {
+                    "id": 30,
+                    "output_name": "output_file"
+                }
+            },
+            "inputs": [],
+            "label": null,
+            "name": "Collapse Collection",
+            "outputs": [
+                {
+                    "name": "output",
+                    "type": "input"
+                }
+            ],
+            "position": {
+                "bottom": 373.5,
+                "height": 152,
+                "left": 2969,
+                "right": 3169,
+                "top": 221.5,
+                "width": 200,
+                "x": 2969,
+                "y": 221.5
+            },
+            "post_job_actions": {
+                "RenameDatasetActionoutput": {
+                    "action_arguments": {
+                        "newname": "Multisample consensus FASTA"
+                    },
+                    "action_type": "RenameDatasetAction",
+                    "output_name": "output"
+                }
+            },
+            "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/4.2",
+            "tool_shed_repository": {
+                "changeset_revision": "830961c48e42",
+                "name": "collapse_collections",
+                "owner": "nml",
+                "tool_shed": "toolshed.g2.bx.psu.edu"
+            },
+            "tool_state": "{\"filename\": {\"add_name\": \"false\", \"__current_case__\": 1}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}",
+            "tool_version": "4.2",
+            "type": "tool",
+            "uuid": "f7ee72ff-b2f3-4c33-9e25-1ed9540cbacb",
+            "workflow_outputs": [
+                {
+                    "label": "multisample_consensus_fasta",
+                    "output_name": "output",
+                    "uuid": "d28c8016-1a6c-4451-a34c-182e7480064d"
+                }
+            ]
+        }
+    },
+    "tags": [
+        "COVID-19",
+        "covid19.galaxyproject.org"
+    ],
+    "uuid": "ac9ad7d0-11ab-43de-9761-9612a46ddd8b",
+    "version": 0
+}
diff --git a/test-data/aligned_reads_for_coverage.bam b/test-data/aligned_reads_for_coverage.bam
new file mode 100644
index 0000000..ef0f72a
Binary files /dev/null and b/test-data/aligned_reads_for_coverage.bam differ
diff --git a/test-data/final_snpeff_annotated_variants.vcf b/test-data/final_snpeff_annotated_variants.vcf
new file mode 100644
index 0000000..d0e860b
--- /dev/null
+++ b/test-data/final_snpeff_annotated_variants.vcf
@@ -0,0 +1,77 @@
+##fileformat=VCFv4.0
+##fileDate=20210221
+##source=lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter --no-default-filter -r NC_045512.2:1-14951 -o /tmp/lofreq2_call_parallelxh3mih1k/0.vcf.gz reads.bam 
+##reference=reference.fa
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw Depth">
+##INFO=<ID=AF,Number=1,Type=Float,Description="Allele Frequency">
+##INFO=<ID=SB,Number=1,Type=Integer,Description="Phred-scaled strand bias at this position">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="Counts for ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=CONSVAR,Number=0,Type=Flag,Description="Indicates that the variant is a consensus variant (as opposed to a low frequency variant).">
+##INFO=<ID=HRUN,Number=1,Type=Integer,Description="Homopolymer length to the right of report indel position">
+##FILTER=<ID=min_snvqual_68,Description="Minimum SNV Quality (Phred) 68">
+##FILTER=<ID=min_indelqual_60,Description="Minimum Indel Quality (Phred) 60">
+##FILTER=<ID=min_snvqual_72,Description="Minimum SNV Quality (Phred) 72">
+##FILTER=<ID=min_indelqual_64,Description="Minimum Indel Quality (Phred) 64">
+##FILTER=<ID=sb_fdr,Description="Strand-Bias Multiple Testing Correction: fdr corr. pvalue > 0.001000">
+##SnpEffVersion="4.5covid19 (build 2020-04-15 22:26), by Pablo Cingolani"
+##SnpEffCmd="SnpEff  -i vcf -o vcf -formatEff -classic -no-downstream -no-intergenic -no-upstream -no-utr -stats /Users/mvandenb/src/galaxy/database/files/8/c/5/dataset_8c59d777-b160-4e19-a2bd-7da3b8b7d54c.dat NC_045512.2 /Users/mvandenb/src/galaxy/database/files/4/f/7/dataset_4f741f76-a82b-464c-85a3-7d29422a36ab.dat "
+##INFO=<ID=EFF,Number=.,Type=String,Description="Predicted effects for this variant.Format: 'Effect ( Effect_Impact | Functional_Class | Codon_Change | Amino_Acid_Change| Amino_Acid_length | Gene_Name | Transcript_BioType | Gene_Coding | Transcript_ID | Exon_Rank  | Genotype [ | ERRORS | WARNINGS ] )' ">
+##INFO=<ID=LOF,Number=.,Type=String,Description="Predicted loss of function effects for this variant. Format: 'Gene_Name | Gene_ID | Number_of_transcripts_in_gene | Percent_of_transcripts_affected'">
+##INFO=<ID=NMD,Number=.,Type=String,Description="Predicted nonsense mediated decay effects for this variant. Format: 'Gene_Name | Gene_ID | Number_of_transcripts_in_gene | Percent_of_transcripts_affected'">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+NC_045512.2	174	.	G	C	17525.0	PASS	DP=585;AF=0.878632;SB=0;DP4=29,8,428,120
+NC_045512.2	235	.	A	G	74.0	PASS	DP=622;AF=0.009646;SB=14;DP4=276,335,0,6
+NC_045512.2	241	.	C	T	604.0	PASS	DP=664;AF=0.049699;SB=4;DP4=247,373,20,21
+NC_045512.2	490	.	T	A	219.0	PASS	DP=106;AF=0.094340;SB=0;DP4=61,35,6,4;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gaT/gaA|D75E|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|A),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gaT/gaA|D75E|179|ORF1ab|protein_coding|CODING|YP_009725297.1|1|A|WARNING_TRANSCRIPT_NO_STOP_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gaT/gaA|D75E|179|ORF1ab|protein_coding|CODING|YP_009742608.1|1|A|WARNING_TRANSCRIPT_NO_STOP_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gaT/gaA|D75E|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|A)
+NC_045512.2	829	.	C	A	112.0	PASS	DP=7454;AF=0.004427;SB=33;DP4=3920,3491,31,7;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aaC/aaA|N188K|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|A),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aaC/aaA|N188K|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|A),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aaC/aaA|N8K|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aaC/aaA|N8K|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	1080	.	A	T	76.0	sb_fdr	DP=7787;AF=0.002568;SB=121;DP4=5505,2251,2,27;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aAt/aTt|N272I|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aAt/aTt|N272I|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aAt/aTt|N92I|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aAt/aTt|N92I|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	1090	.	T	C	297.0	sb_fdr	DP=8170;AF=0.006365;SB=265;DP4=5484,2615,3,63;EFF=SYNONYMOUS_CODING(LOW|SILENT|ttT/ttC|F275|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|C),SYNONYMOUS_CODING(LOW|SILENT|ttT/ttC|F275|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|C),SYNONYMOUS_CODING(LOW|SILENT|ttT/ttC|F95|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|C|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|ttT/ttC|F95|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|C|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	1135	.	G	A	179.0	sb_fdr	DP=8072;AF=0.006442;SB=145;DP4=3986,3997,68,5;EFF=SYNONYMOUS_CODING(LOW|SILENT|aaG/aaA|K290|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|A),SYNONYMOUS_CODING(LOW|SILENT|aaG/aaA|K290|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|A),SYNONYMOUS_CODING(LOW|SILENT|aaG/aaA|K110|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|aaG/aaA|K110|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	1150	.	C	G	115.0	sb_fdr	DP=7683;AF=0.003384;SB=104;DP4=3261,4364,32,1;EFF=SYNONYMOUS_CODING(LOW|SILENT|ggC/ggG|G295|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|G),SYNONYMOUS_CODING(LOW|SILENT|ggC/ggG|G295|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|G),SYNONYMOUS_CODING(LOW|SILENT|ggC/ggG|G115|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|G|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|ggC/ggG|G115|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|G|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	1181	.	G	T	210.0	sb_fdr	DP=7962;AF=0.005401;SB=78;DP4=2405,5502,0,52;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V306F|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V306F|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V126F|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V126F|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	1594	.	C	T	450.0	PASS	DP=15;AF=0.866667;SB=0;DP4=0,0,4,11;EFF=SYNONYMOUS_CODING(LOW|SILENT|tcC/tcT|S443|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),SYNONYMOUS_CODING(LOW|SILENT|tcC/tcT|S443|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),SYNONYMOUS_CODING(LOW|SILENT|tcC/tcT|S263|637|ORF1ab|protein_coding|CODING|YP_009725298.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|tcC/tcT|S263|637|ORF1ab|protein_coding|CODING|YP_009742609.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	3037	.	C	T	3073.0	PASS	DP=108;AF=0.842593;SB=13;DP4=7,4,30,67;EFF=SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F924|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F924|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F106|1944|ORF1ab|protein_coding|CODING|YP_009725299.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F106|1944|ORF1ab|protein_coding|CODING|YP_009742610.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	3177	.	C	T	133.0	PASS	DP=64;AF=0.093750;SB=1;DP4=20,38,1,5;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P971L|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P971L|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P153L|1944|ORF1ab|protein_coding|CODING|YP_009725299.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P153L|1944|ORF1ab|protein_coding|CODING|YP_009742610.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	3874	.	C	T	275.0	PASS	DP=18;AF=0.500000;SB=0;DP4=9,0,9,0;EFF=SYNONYMOUS_CODING(LOW|SILENT|atC/atT|I1203|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),SYNONYMOUS_CODING(LOW|SILENT|atC/atT|I1203|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),SYNONYMOUS_CODING(LOW|SILENT|atC/atT|I385|1944|ORF1ab|protein_coding|CODING|YP_009725299.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|atC/atT|I385|1944|ORF1ab|protein_coding|CODING|YP_009742610.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	6285	.	C	T	256.0	PASS	DP=13;AF=0.615385;SB=0;DP4=4,1,6,2;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCc/aTc|T2007I|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCc/aTc|T2007I|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCc/aTc|T1189I|1944|ORF1ab|protein_coding|CODING|YP_009725299.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCc/aTc|T1189I|1944|ORF1ab|protein_coding|CODING|YP_009742610.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	6696	.	C	CT	98.0	PASS	DP=142;AF=0.028169;SB=0;DP4=43,98,1,3;INDEL;HRUN=4;EFF=FRAME_SHIFT(HIGH||ctt/Tctt|L2146S?|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|CT|INFO_REALIGN_3_PRIME),FRAME_SHIFT(HIGH||ctt/Tctt|L2146S?|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|CT|INFO_REALIGN_3_PRIME),FRAME_SHIFT(HIGH||ctt/Tctt|L1328S?|1944|ORF1ab|protein_coding|CODING|YP_009725299.1|1|CT|WARNING_TRANSCRIPT_NO_START_CODON&INFO_REALIGN_3_PRIME),FRAME_SHIFT(HIGH||ctt/Tctt|L1328S?|1944|ORF1ab|protein_coding|CODING|YP_009742610.1|1|CT|WARNING_TRANSCRIPT_NO_START_CODON&INFO_REALIGN_3_PRIME);LOF=(ORF1ab|GU280_gp01|28|0.14)
+NC_045512.2	8290	.	C	T	3071.0	PASS	DP=109;AF=0.844037;SB=10;DP4=9,6,31,63;EFF=SYNONYMOUS_CODING(LOW|SILENT|ctC/ctT|L2675|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),SYNONYMOUS_CODING(LOW|SILENT|ctC/ctT|L2675|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),SYNONYMOUS_CODING(LOW|SILENT|ctC/ctT|L1857|1944|ORF1ab|protein_coding|CODING|YP_009725299.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|ctC/ctT|L1857|1944|ORF1ab|protein_coding|CODING|YP_009742610.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	8782	.	C	T	132.0	PASS	DP=18;AF=0.277778;SB=0;DP4=7,5,3,3;EFF=SYNONYMOUS_CODING(LOW|SILENT|agC/agT|S2839|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),SYNONYMOUS_CODING(LOW|SILENT|agC/agT|S2839|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),SYNONYMOUS_CODING(LOW|SILENT|agC/agT|S76|499|ORF1ab|protein_coding|CODING|YP_009725300.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),SYNONYMOUS_CODING(LOW|SILENT|agC/agT|S76|499|ORF1ab|protein_coding|CODING|YP_009742611.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	11109	.	C	T	3397.0	PASS	DP=106;AF=0.924528;SB=0;DP4=6,0,93,7;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gCt/gTt|A3615V|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gCt/gTt|A3615V|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gCt/gTt|A46V|289|ORF1ab|protein_coding|CODING|YP_009725302.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gCt/gTt|A46V|289|ORF1ab|protein_coding|CODING|YP_009742613.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	11653	.	CT	C	139.0	PASS	DP=211;AF=0.028436;SB=2;DP4=162,43,4,2;INDEL;HRUN=4;EFF=FRAME_SHIFT(HIGH||tgt/|C3798|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|C|INFO_REALIGN_3_PRIME),FRAME_SHIFT(HIGH||tgt/|C3798|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|C|INFO_REALIGN_3_PRIME),FRAME_SHIFT(HIGH||tgt/|C229|289|ORF1ab|protein_coding|CODING|YP_009725302.1|1|C|WARNING_TRANSCRIPT_NO_START_CODON&INFO_REALIGN_3_PRIME),FRAME_SHIFT(HIGH||tgt/|C229|289|ORF1ab|protein_coding|CODING|YP_009742613.1|1|C|WARNING_TRANSCRIPT_NO_START_CODON&INFO_REALIGN_3_PRIME);LOF=(ORF1ab|GU280_gp01|28|0.14)
+NC_045512.2	12662	.	G	A	243.0	PASS	DP=2923;AF=0.008895;SB=1;DP4=749,2142,8,19;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gcc/Acc|A4133T|7096|ORF1ab|protein_coding|CODING|GU280_gp01|1|A),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gcc/Acc|A4133T|4405|ORF1ab|protein_coding|CODING|GU280_gp01.2|1|A),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gcc/Acc|A191T|197|ORF1ab|protein_coding|CODING|YP_009725304.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gcc/Acc|A191T|197|ORF1ab|protein_coding|CODING|YP_009742615.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	14398	.	G	T	124.0	PASS	DP=101;AF=0.059406;SB=1;DP4=51,44,4,2;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtg/Ttg|V4712L|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtg/Ttg|V320L|931|ORF1ab|protein_coding|CODING|YP_009725307.1|2|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	14408	.	C	T	3058.0	PASS	DP=103;AF=0.873786;SB=1;DP4=3,5,48,47;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P4715L|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P323L|931|ORF1ab|protein_coding|CODING|YP_009725307.1|2|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	15960	.	C	T	341.0	PASS	DP=127;AF=0.118110;SB=1;DP4=93,18,13,3;EFF=SYNONYMOUS_CODING(LOW|SILENT|gcC/gcT|A5232|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),SYNONYMOUS_CODING(LOW|SILENT|gcC/gcT|A840|931|ORF1ab|protein_coding|CODING|YP_009725307.1|2|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	17747	.	C	T	225.0	PASS	DP=38;AF=0.236842;SB=12;DP4=11,18,7,2;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P5828L|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cCt/cTt|P504L|600|ORF1ab|protein_coding|CODING|YP_009725308.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	17858	.	A	G	296.0	PASS	DP=28;AF=0.392857;SB=0;DP4=6,9,5,8;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|tAt/tGt|Y5865C|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|G),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|tAt/tGt|Y541C|600|ORF1ab|protein_coding|CODING|YP_009725308.1|1|G|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	17874	.	C	T	292.0	PASS	DP=23;AF=0.434783;SB=0;DP4=4,8,4,7;EFF=SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F5870|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F546|600|ORF1ab|protein_coding|CODING|YP_009725308.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	18788	.	C	T	4057.0	PASS	DP=138;AF=0.876812;SB=0;DP4=6,6,58,67;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCa/aTa|T6175I|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCa/aTa|T250I|526|ORF1ab|protein_coding|CODING|YP_009725309.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	19684	.	G	T	501.0	PASS	DP=146;AF=0.143836;SB=0;DP4=105,19,19,3;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gta/Tta|V6474L|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gta/Tta|V22L|345|ORF1ab|protein_coding|CODING|YP_009725310.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	20209	.	AGTAGAAATT	A	14928.0	PASS	DP=472;AF=0.959746;SB=21;DP4=12,7,398,55;INDEL;HRUN=1;EFF=CODON_CHANGE_PLUS_CODON_DELETION(MODERATE||agtagaaattta/ata|SRNL6649I|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|A),CODON_CHANGE_PLUS_CODON_DELETION(MODERATE||agtagaaattta/ata|SRNL197I|345|ORF1ab|protein_coding|CODING|YP_009725310.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	20287	.	G	A	84.0	sb_fdr	DP=1788;AF=0.006711;SB=83;DP4=1420,356,0,12;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gaa/Aaa|E6675K|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|A),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gaa/Aaa|E223K|345|ORF1ab|protein_coding|CODING|YP_009725310.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	20298	.	A	T	88.0	sb_fdr	DP=2107;AF=0.006645;SB=98;DP4=1589,501,0,16;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aaA/aaT|K6678N|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aaA/aaT|K226N|345|ORF1ab|protein_coding|CODING|YP_009725310.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	20798	.	AT	A	76.0	PASS	DP=778;AF=0.006427;SB=0;DP4=597,176,4,1;INDEL;HRUN=1;EFF=FRAME_SHIFT(HIGH||tat/|Y6845|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|A),FRAME_SHIFT(HIGH||tat/|Y47|297|ORF1ab|protein_coding|CODING|YP_009725311.1|1|A|WARNING_TRANSCRIPT_NO_START_CODON);LOF=(ORF1ab|GU280_gp01|28|0.04)
+NC_045512.2	20868	.	T	G	125.0	sb_fdr	DP=5641;AF=0.004432;SB=196;DP4=4376,1233,0,30;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|ttT/ttG|F6868L|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|G),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|ttT/ttG|F70L|297|ORF1ab|protein_coding|CODING|YP_009725311.1|1|G|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	20908	.	G	T	80.0	sb_fdr	DP=8126;AF=0.003569;SB=167;DP4=5445,2630,2,40;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V6882F|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V84F|297|ORF1ab|protein_coding|CODING|YP_009725311.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	21134	.	A	G	163.0	PASS	DP=1677;AF=0.008945;SB=3;DP4=218,1441,3,12;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cAa/cGa|Q6957R|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|G),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|cAa/cGa|Q159R|297|ORF1ab|protein_coding|CODING|YP_009725311.1|1|G|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	21526	.	A	T	111.0	PASS	DP=1208;AF=0.011589;SB=23;DP4=783,404,7,14;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Att/Ttt|I7088F|7096|ORF1ab|protein_coding|CODING|GU280_gp01|2|T),NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Att/Ttt|I290F|297|ORF1ab|protein_coding|CODING|YP_009725311.1|1|T|WARNING_TRANSCRIPT_NO_START_CODON)
+NC_045512.2	21578	.	G	T	76.0	PASS	DP=1345;AF=0.008178;SB=13;DP4=476,850,2,15;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtt/Ttt|V6F|1273|S|protein_coding|CODING|GU280_gp02|1|T)
+NC_045512.2	22712	.	C	T	125.0	sb_fdr	DP=8681;AF=0.003456;SB=99;DP4=4028,4617,30,0;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Cct/Tct|P384S|1273|S|protein_coding|CODING|GU280_gp02|1|T)
+NC_045512.2	22721	.	T	A	98.0	sb_fdr	DP=8884;AF=0.003489;SB=139;DP4=3798,5040,42,1;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Tta/Ata|L387I|1273|S|protein_coding|CODING|GU280_gp02|1|A)
+NC_045512.2	22810	.	A	G	72.0	sb_fdr	DP=6269;AF=0.003828;SB=142;DP4=1565,4675,26,1;EFF=SYNONYMOUS_CODING(LOW|SILENT|ggA/ggG|G416|1273|S|protein_coding|CODING|GU280_gp02|1|G)
+NC_045512.2	23262	.	G	A	131.0	sb_fdr	DP=7418;AF=0.003101;SB=126;DP4=5307,2085,0,23;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aGa/aAa|R567K|1273|S|protein_coding|CODING|GU280_gp02|1|A)
+NC_045512.2	23269	.	T	C	2250.0	PASS	DP=7958;AF=0.020985;SB=3;DP4=5454,2326,126,46;EFF=SYNONYMOUS_CODING(LOW|SILENT|atT/atC|I569|1273|S|protein_coding|CODING|GU280_gp02|1|C)
+NC_045512.2	23280	.	C	A	108.0	sb_fdr	DP=8464;AF=0.003781;SB=63;DP4=5576,2848,37,0;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|aCt/aAt|T573N|1273|S|protein_coding|CODING|GU280_gp02|1|A)
+NC_045512.2	23315	.	C	T	120.0	PASS	DP=8454;AF=0.005086;SB=45;DP4=4491,3907,40,8;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Ctt/Ttt|L585F|1273|S|protein_coding|CODING|GU280_gp02|1|T)
+NC_045512.2	23338	.	T	G	205.0	sb_fdr	DP=8806;AF=0.006246;SB=164;DP4=3994,4739,1,68;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|ttT/ttG|F592L|1273|S|protein_coding|CODING|GU280_gp02|1|G)
+NC_045512.2	23364	.	G	A	76.0	sb_fdr	DP=8261;AF=0.003753;SB=59;DP4=2822,5390,1,40;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gGa/gAa|G601E|1273|S|protein_coding|CODING|GU280_gp02|1|A)
+NC_045512.2	23511	.	TA	T	127.0	PASS	DP=891;AF=0.007856;SB=0;DP4=172,796,1,6;INDEL;HRUN=2;EFF=FRAME_SHIFT(HIGH||ata/|I651|1273|S|protein_coding|CODING|GU280_gp02|1|T|INFO_REALIGN_3_PRIME);LOF=(S|GU280_gp02|1|1.00)
+NC_045512.2	23513	.	AT	A	160.0	PASS	DP=671;AF=0.016393;SB=1;DP4=149,597,1,10;INDEL;HRUN=1;EFF=FRAME_SHIFT(HIGH||ata/|I651|1273|S|protein_coding|CODING|GU280_gp02|1|A);LOF=(S|GU280_gp02|1|1.00)
+NC_045512.2	23517	.	G	C	83.0	PASS	DP=74;AF=0.108108;SB=18;DP4=37,28,1,8;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|gGg/gCg|G652A|1273|S|protein_coding|CODING|GU280_gp02|1|C)
+NC_045512.2	25563	.	G	T	1722.0	PASS	DP=59;AF=0.847458;SB=0;DP4=0,5,4,50;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|caG/caT|Q57H|275|ORF3a|protein_coding|CODING|GU280_gp03|1|T)
+NC_045512.2	28077	.	G	C	166.0	PASS	DP=93;AF=0.086022;SB=1;DP4=20,63,1,8;EFF=NON_SYNONYMOUS_CODING(MODERATE|MISSENSE|Gtg/Ctg|V62L|121|ORF8|protein_coding|CODING|GU280_gp09|1|C)
+NC_045512.2	28214	.	C	CT	72.0	PASS	DP=105;AF=0.028571;SB=0;DP4=85,17,3,0;INDEL;HRUN=5;EFF=FRAME_SHIFT(HIGH||tta/ttTa|L109F?|121|ORF8|protein_coding|CODING|GU280_gp09|1|CT|INFO_REALIGN_3_PRIME);LOF=(ORF8|GU280_gp09|1|1.00)
+NC_045512.2	28253	.	C	T	145.0	PASS	DP=103;AF=0.077670;SB=0;DP4=67,26,7,3;EFF=SYNONYMOUS_CODING(LOW|SILENT|ttC/ttT|F120|121|ORF8|protein_coding|CODING|GU280_gp09|1|T)
+NC_045512.2	29700	.	A	G	335.0	PASS	DP=139;AF=0.107914;SB=0;DP4=45,78,5,10
diff --git a/test-data/masked_consensus.fa b/test-data/masked_consensus.fa
new file mode 100644
index 0000000..0326125
--- /dev/null
+++ b/test-data/masked_consensus.fa
@@ -0,0 +1,500 @@
+>SRR11578257
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
+CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCCTCTATC
+TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
+CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAAC
+ACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGG
+AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA
+TCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGA
+ACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGG
+CCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAAGCTTC
+ATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCG
+TGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCA
+GACACCTTTTGAAATTAAATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAA
+TTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAACCAAGGGTTGAAAAGAAAAA
+GCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATG
+CAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCA
+GACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGA
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNACCAAACCAACCATATCCAAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGA
+TGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACT
+AGTTGCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNGGGTATTATTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAA
+GCATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNGTATAATGCTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTG
+TTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGACTCTTGGTGTTTATGA
+TTACTTAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGTTGGGTGTTGGTGGCAAACCTTG
+TATCAAAGTAGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTT
+ACTCNNNNNTTTGCAACAACTCAGAGTAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGT
+TGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGC
+ATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAG
+TGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCTTTAAG
+GGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGAT
+GTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTA
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGTGTTCCATTT
+GTAGTTTCAACTGGATACCACTTCAGAGAGCTAGGTGTTGTACATAATNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTTTAATGCA
+ATTGCAACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAAG
+AGTCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATACAGCT
+TGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAATATTTGCCTATAGAT
+AAATGTAGTAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCAAAGTG
+AATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNTCTATAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNTTTATAGGTNNNNNNNNNNNNNNNNATGATCTGTATTGTCAAGTCCATGGTAATGCA
+CATGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGTCTAGCTGTCCACGAGTGCTTTGTT
+ANNNNNNNNNNNNNNNNNATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCG
+GCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCA
+GTTCTTCACGACATTGGTAACCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTCAGANNNNNNNNNTA
+CAAGAATTTAAACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAA
+TTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTT
+AGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAA
+TCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATA
+ACAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGAT
+GATTTTGTTGAAATAATAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATATACTCAACTGTGTCAATATTTA
+AACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCT
+GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTG
+CTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGAT
+TGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTACGACCCT
+AAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGT
+GGGTTTATACAACAAAAGCTAGCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNTTTATTTGACATGAGTAAATTTCCCCTTAAATTA
+AGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTT
+CTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTT
+CTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG
+TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCAC
+ACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTCTCTCA
+GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGT
+GTTTAAGAATATTGATGGTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNCAACAGAATCTATTGTTAGATTTCCTAATATTAC
+AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTG
+GAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATC
+ATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTAC
+TAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG
+GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGT
+TATAGCTTGGAATTCTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAAAAAGTCTACTAATTT
+GGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTAC
+TGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC
+TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGG
+TGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCA
+GGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTG
+GCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCTTTT
+GTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGA
+ACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACC
+AATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAG
+CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTT
+CATCAAACAATATGGTGATTGCCTTGGTGATATNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNACACTGGTGTTGAACATGTTACNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACNNNNNNNGGTTCATCCGGAGTTGTT
+AATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNN