ESO - Evolutionary Stability Optimizer

ESO detects hypermutable sites in engineered DNA sequences and optimizes them away with DNAChisel, while preserving the amino-acid translation and optimizing for host codon usage. This implementation follows the approach introduced in Menuhin-Gruman et al. (2022, ACS Synthetic Biology) - see Citation below.

Genes built from repetitive or duplicated DNA elements (a side effect of standard codon optimization, which tends to reuse the same "best" codon repeatedly) are prone to mutate away during propagation in a host organism, through mechanisms like replication slippage and recombination-mediated deletion. ESO detects these hotspots and asks DNAChisel to route around them while it optimizes, using the empirical mutation-rate model from the EFM Calculator (Jack et al., 2015, ACS Synthetic Biology).

Quickstart

1. Requirements: Python 3.11 or newer. Check what you have installed:

python --version

If that prints something below Python 3.11, or fails with "command not found"/"not recognized", install a current version from python.org/downloads first (the installer's default settings are fine) before continuing.

2. Install ESO. In a terminal, cd into this folder (the one this README is in), then:

pip install .

This can take a minute or two the first time. If it ends with a line that doesn't contain the word error, it worked - skip to step 3. If you do see an error, check Troubleshooting below before asking for help.

3. Try it on a real sequence. Put a FASTA file (a plain text file starting with a > line, then the DNA sequence) in a folder by itself, e.g. my_sequences/gene.fasta containing:

>my_gene
ATGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTTAA

Then run:

eso-optimize --input-folder my_sequences --output-path my_results

4. Check the result. Look inside my_results/gene/ - final_sequence.txt has the optimized sequence, recombination_sites.csv/slippage_sites.csv list what was detected and fixed. If the very last line printed to the terminal was Success!, it worked.

That's the whole loop. Everything below this point is reference material for going further (different host organisms, custom scoring, locking regions from editing, and so on) - not required to get a first result.

If you'd rather be walked through setup interactively instead of reading this file, try the ESO Onboarding Assistant, a ChatGPT assistant configured specifically for onboarding onto this tool (see docs/custom-gpt-setup.md for its configuration).

Troubleshooting

• 'eso-optimize' is not recognized / command not found: eso-optimize (common on Windows right after a fresh install): the command was installed, but its folder isn't on your terminal's PATH yet. Use this instead - it always works, no PATH needed:

  python -m eso.cli --input-folder my_sequences --output-path my_results

  (Every eso-optimize ... example in this README works identically as python -m eso.cli ....)

• An error mentioning Microsoft Visual Studio, CMake, or "failed building wheel" during pip install .: this means pip tried to compile a dependency from source instead of using a prebuilt version - almost always fixed by upgrading pip first (python -m pip install --upgrade pip) and trying the install again, since an older pip can miss prebuilt wheels that a newer one finds.

• ModuleNotFoundError or ImportError right after install: double check you're running python/eso-optimize from the same Python installation you ran pip install . with. If you're not sure, run python -m pip show eso - if that fails, you installed into a different Python than the one you're now running.

• "No such file or directory" for your input folder: --input-folder is relative to wherever your terminal's current directory is - either cd there first, or use a full path (e.g. C:\Users\you\my_sequences or /Users/you/my_sequences).

• Nothing in the output folder / an empty results list: ESO looks for files ending in .fasta/.fna/.ffn/.faa/.frn/.fa/.gb/.gbk/.genbank (optionally gzipped), directly inside --input-folder or one level under it - check your file's extension matches one of those.

• Anything else: the error messages this tool prints are meant to be read directly and acted on (not just a Python traceback to decode) - if one isn't clear, that's a bug in the tool itself, worth reporting rather than working around.

What it detects

• Replication slippage - short tandem repeats (a base unit of length 1-15 repeated 3+ times, or a single nucleotide repeated 4+ times) that polymerase can skip or duplicate during replication.
• Recombination-mediated deletion (RMD) - pairs of near-identical sites (16+ nt, within Levenshtein distance 1 of each other) that homologous recombination can delete between.
• Methylation motifs - sequence motifs recognized by host methylation machinery, which can trigger repair-associated mutation. Given as a PSSM/MEME file, a bundled common motif (E. coli's Dam/Dcm systems), or your own IUPAC consensus string (e.g. "GATC") - no file needed for either of the latter two.

Two independently-developed implementations of the recombination/slippage detectors are included (eso.detection.recombination/eso.detection.slippage, and eso.detection.staubility_variant) - they haven't yet been reconciled into a single canonical algorithm. Both are routed through eso.detection.dispatch (find_recombination_sites(seq, num_sites, mode="thorough" | "fast") and find_slippage_sites(seq, num_sites, mode="default" | "fast")), also exposed via eso.pipeline.main(..., recombination_mode=..., slippage_mode=...) / eso-optimize --recombination-mode --slippage-mode. See docs/detector-comparisons.md for the tradeoffs, benchmarks, and bugs found while comparing them - recombination's two modes trade off sensitivity for speed, but slippage's are fully equivalent in what they detect (a pure speed choice). Methylation motif detection only has one implementation (eso.detection.methylation) - a second was built and compared, but deleted after it turned out to disagree in accuracy, not just speed (see the same doc for the writeup).

Not included: STABLES also carried a junction-linker hotspot checker (linker_suspect_utils.py), applying the same slippage/recombination-detection idea to a different, narrower problem - checking whether joining a target gene to a host sequence via a linker creates a new hotspot at the junction. It was ported into an earlier version of this repo (eso.detection.junction_linker) but removed: its detection thresholds (a 4-repeat homopolymer check, a 12-mer recombination check) don't match the calibrated -9 filter this codebase's other detectors use, and tracing them back into the original STABLES select_fusion_linkers.py pipeline showed they act as a near-absolute veto in STABLES' own linker-selection algorithm - deliberate, STABLES-specific conservatism for screening many cheap, redesignable linker candidates, not a general-purpose hotspot detector. That's a different problem from ESO's (evaluating one already-chosen sequence), so it was judged out of scope for this library rather than reconciled with the other detectors' thresholds.

Install

poetry install
# or: pip install -e .

Word-document diff reports (eso.report) need the optional docx-report extra:

poetry install -E docx-report

Usage

from eso import main

message, results = main(
    input_folder="path/to/fasta_files",
    output_path="path/to/output",
    optimize=True,
    mini_gc=0.3,
    maxi_gc=0.7,
    method="use_best_codon",
    organism_name="e_coli",  # or a TaxID, or a bundled table (see eso.codon_usage)
)

Or from the command line:

eso-optimize --input-folder path/to/fasta_files --output-path path/to/output --organism-name e_coli

For each FASTA/GenBank file found in input_folder, this writes to output_path/<file_stem>/:

• final_sequence.txt - the optimized sequence, plus CAI-before/after and edit-count stats.
• recombination_sites.csv / slippage_sites.csv / motif_sites.csv - detected hotspots.
• sequence_comparison.docx - a diff view of original vs. optimized sequence (if the docx-report extra is installed).

organism_name accepts anything supported by python-codon-tables (a species name or NCBI TaxID), or one of the bundled custom tables in eso.codon_usage.CODON_USAGE_TABLES (C1, kompas, human_antibody_heavy_chain, human_antibody_light_chain) for hosts not in that database.

See examples/antibody_optimization for a complete worked example (human antibody heavy/light chain optimization).

Using ESO as a library, instead of files

main() (above) is file-in, file-out - convenient for a one-off CLI run, but if you already have sequences in memory as part of your own code (e.g. generated, fetched from a database, or produced by an earlier step in your own pipeline), you don't need to write them to disk first. eso.optimize.optimization_engine (also importable as eso.optimization_engine) takes a plain DNA string and returns a plain DNA string - no files involved:

from eso import optimization_engine, suspect_site_extractor

seq = "ATG" + "GCT" * 15 + "TAA"  # any DNA string you already have

# 1. detect hotspots (skip this step and the dataframes below entirely if you only
#    want codon/GC optimization, with no hotspot avoidance)
sites = suspect_site_extractor(seq, compute_motifs=False, num_sites=50)

# 2. optimize, avoiding what was detected
final_seq, objectives_summary, num_edits = optimization_engine(
    seq,
    organism_name="e_coli",
    df_recombination=sites["df_recombination"],
    df_slippage=sites["df_slippage"],
)

final_seq is a plain str you can feed straight back into whatever your own code does next (write it out yourself, pass it to another function, etc.) - nothing here touches the filesystem. suspect_site_extractor (also importable as eso.suspect_site_extractor) is the same detection step main() runs internally; call it on its own if you only want the hotspot dataframes, with no optimization at all.

This composes directly with a custom scoring function - just pass custom_score_fn=... to optimization_engine instead of organism_name:

final_seq, _, num_edits = optimization_engine(
    seq,
    custom_score_fn=my_model.predict,  # any function: whole seq (str) -> a number, higher = better
    df_recombination=sites["df_recombination"],
    df_slippage=sites["df_slippage"],
)

See optimization_engine's docstring (eso/optimize.py) for every parameter (mini_gc/maxi_gc, orf_regions/exclusion_regions, method, and so on) - everything available via main()/the CLI is available here too, just without the file layer.

Scoring sequences your own way, instead of CAI/tAI

By default, optimization scores codon choices against a codon-usage table (CAI/tAI-style, via organism_name). To score sequences with your own logic instead, write a Python file defining a score(seq) function (seq is a plain DNA string like "ATGCGT...", the whole ORF being optimized; return a number, higher = better) - copy examples/custom_score_template.py as a starting point.

From the command line:

eso-optimize --input-folder path/to/fasta_files --custom-score-file my_score.py

(--custom-score-file overrides --organism-name/--method.) A --custom-score-file with a mistake in it - a missing score function, a typo, a function that crashes or returns the wrong type - fails immediately with a plain-English message, before any optimization runs, rather than surfacing later as a Python traceback.

From Python, either call optimization_engine/eso.pipeline.main directly with custom_score_fn/custom_score_minimize, or reuse the same file-loading + validation the CLI uses via eso.custom_score.load_custom_score_from_file:

from eso.custom_score import load_custom_score_from_file
from eso.optimize import optimization_engine

score_fn = load_custom_score_from_file("my_score.py")  # same validation as the CLI
final_seq, _, _ = optimization_engine(seq, custom_score_fn=score_fn)

# or, skipping the file entirely:
final_seq, _, _ = optimization_engine(
    seq,
    custom_score_fn=lambda whole_orf: whole_orf.count("G") + whole_orf.count("C"),
)

custom_score_fn is called once on the whole ORF being optimized, on every trial mutation tried during optimize() - this can be slow for a long sequence or an expensive function (a warning is raised). custom_score_minimize=True (--custom-score-minimize on the CLI) treats a lower custom_score_fn value as better, instead of higher.

Scope: custom scoring is automatically restricted to orf_regions (one scored region per ORF, matching how the built-in CAI/tAI codon-usage scoring is already scoped via DNAChisel's CodonOptimize(location=orf, ...)) - custom_score_fn never sees any non-ORF flanking sequence (UTRs, locked/excluded regions). If you don't pass orf_regions, this is the whole sequence (trimmed to a multiple of 3), same as everywhere else in ESO.

An earlier version of this feature also supported a "windowed" mode (scoring fixed-size chunks and summing them, mirroring how the built-in CAI/tAI scoring works internally) as a claimed speed optimization. It was removed after benchmarking found no case where it was actually faster than the whole-ORF evaluation above - comparable at best, meaningfully slower at worst, since DNAChisel's own optimizer ends up calling the score function considerably more often when it's chunk-localizable - while carrying a real, unpreventable correctness risk (a score that doesn't genuinely decompose per-chunk, true of most real external/ML models, would silently compute a different, structurally unrelated quantity, with no reliable way to detect this automatically). See docs/detector-comparisons.md for the full investigation, including an initial benchmark that was itself flawed and had to be corrected before the removal decision was made.

Restricting ORF and exclusion regions per sequence

By default, the entire sequence is treated as one in-frame, translation-preserving ORF with nothing locked. To instead give each sequence its own ORF region(s) (e.g. skip a UTR) and/or exclusion regions that must never be edited (e.g. a known regulatory element), pass indexes (from Python) or --indexes-file (from the CLI).

From the command line, point at a JSON file - copy examples/indexes_template.json as a starting point:

[
  {
    "file": "my_gene",
    "seq_index": "0",
    "orf_regions": "1-6, 51-68",
    "exclusion_regions": "1-6, 50-68"
  }
]

eso-optimize --input-folder path/to/fasta_files --indexes-file indexes.json

• file is the FASTA/GenBank file's stem (no extension, e.g. "my_gene" for my_gene.fasta).
• seq_index is which record within that file, 0-indexed in file order, as a string.
• orf_regions/exclusion_regions are 1-indexed, inclusive region strings (e.g. "1-6, 51-68" for two separate regions); omit exclusion_regions (or use "") for no exclusions.

A malformed --indexes-file (bad JSON, missing file/seq_index) fails immediately with a plain-English message; malformed region strings themselves are validated the same way whether indexes came from a file or was passed directly to eso.pipeline.main/main.

From Python, pass the equivalent dict directly:

from eso import main

message, results = main(
    input_folder="path/to/fasta_files",
    indexes={("my_gene", "0"): ("1-6, 51-68", "1-6, 50-68")},
)

Motif sources: methylation, cryptic ribosome binding, cryptic promoters, and your own

Motif detection (--compute-motifs) isn't only about methylation - the same PSSM-based scanner (eso.detection.methylation.find_motif_sites) works for any short sequence motif you want to flag. Needs at least one motif, from any combination of three sources:

• A MEME-minimal-format PSSM file (--motifs-path / motifs_path=) - the original option, for a curated or experimentally-derived motif set you already have as a file.

• Bundled common motifs (--common-motifs dam,dcm / common_motifs=["dam", "dcm"])

  • no file needed. See eso/detection/common_motifs.py (COMMON_MOTIFS) for the full list and sources; currently:
  • Methylation (E. coli, already a first-class host here - see eso.codon_usage's bundled e_coli table): dam (GATC, N6-methyladenine), dcm (CCWGG, C5-methylcytosine on the internal C).
  • Cryptic ribosome binding: shine_dalgarno (AGGAGG) - flags a copy of the bacterial RBS consensus occurring inside a coding region, a known source of unintended internal translation initiation.
  • Cryptic bacterial promoter elements: sigma70_minus35 (TTGACA), sigma70_minus10 (TATAAT) - the two sigma70 hexamers; an accidental occurrence of either inside a coding sequence is a classic source of unwanted transcription. Each hexamer is flagged independently (a real promoter needs both, correctly spaced, which this detector doesn't check for) - treat an isolated hit as a coarse screen, not a confirmed cryptic promoter.
  • Not included, and why (see the module docstring for the full explanation): transcription terminators (a secondary-structure property, not a fixed linear motif), the Kozak sequence (something to match, not avoid - a different problem), and restriction enzyme sites (already covered comprehensively by DNAChisel's own dnachisel.list_common_enzymes() / EnzymeSitePattern, usable directly with AvoidPattern during optimization - no need to duplicate it here).

• Your own IUPAC consensus string - the easy custom-motif path, no PSSM/MEME file needed:

  from eso.detection.motif_utils import motif_from_consensus, motifs_from_consensus_dict
  
  my_motif = motif_from_consensus("my_site", "GANTC")  # N = any base, standard IUPAC codes
  # or define several at once:
  my_motifs = motifs_from_consensus_dict({"site_a": "GATC", "site_b": "CCWGG"})

  Pass the result as relevant_motifs to eso.detection.methylation.find_motif_sites directly, or combine with the other two sources yourself before calling it - there's no CLI flag for this one yet (a MEME file is still the CLI's path for anything beyond the bundled common motifs).

Most published methylation/restriction motifs (REBASE, NEB's technical notes, the primary literature) are naturally given exactly this way - a short consensus sequence with IUPAC ambiguity codes (W = A or T, N = any base, etc.) - not as a position-probability matrix, so this avoids hand-authoring a MEME file just to check for one. For organisms beyond E. coli, REBASE is the standard reference database for methylation motifs - look up the motif there and pass it straight to motif_from_consensus.

Development

poetry install --with dev
pytest

Citation

If you use this tool, please cite the paper it implements:

Menuhin-Gruman, I., Arbel, M., Amitay, N., Sionov, K., Naki, D., Katzir, I., Edgar, O., Bergman, S., & Tuller, T. (2022). Evolutionary Stability Optimizer (ESO): A Novel Approach to Identify and Avoid Mutational Hotspots in DNA Sequences While Maintaining High Expression Levels. ACS Synthetic Biology, 11(3), 1142-1151. https://doi.org/10.1021/acssynbio.1c00426

@article{menuhingruman2022eso,
  title   = {Evolutionary Stability Optimizer (ESO): A Novel Approach to Identify and
             Avoid Mutational Hotspots in DNA Sequences While Maintaining High
             Expression Levels},
  author  = {Menuhin-Gruman, Itamar and Arbel, Matan and Amitay, Niv and Sionov, Karin
             and Naki, Doron and Katzir, Itai and Edgar, Omer and Bergman, Shaked
             and Tuller, Tamir},
  journal = {ACS Synthetic Biology},
  volume  = {11},
  number  = {3},
  pages   = {1142--1151},
  year    = {2022},
  doi     = {10.1021/acssynbio.1c00426}
}

License

MIT