diff --git a/CHANGES.md b/CHANGES.md
index f2af464..ac2660b 100644
--- a/CHANGES.md
+++ b/CHANGES.md
@@ -1,5 +1,9 @@
 # CHANGES
 
+## 5.3.0
+
+* Support for paired FASTQ names ending with `_R1_001` and `_R2_001` in addition to `_1` and `_2` as before.
+
 ## 5.2.2
 
 * Delete files that may remain after an aborted run before resume.
diff --git a/Dockerfile b/Dockerfile
index b93fd18..b28ee09 100644
--- a/Dockerfile
+++ b/Dockerfile
@@ -62,7 +62,7 @@ FROM  ubuntu:20.04
 
 LABEL maintainer="cgphelp@sanger.ac.uk"\
       uk.ac.sanger.cgp="Cancer, Ageing and Somatic Mutation, Wellcome Sanger Institute" \
-      version="5.2.2" \
+      version="5.3.0" \
       description="pcap-core"
 
 ENV OPT /opt/wtsi-cgp
diff --git a/bin/bwa_aln.pl b/bin/bwa_aln.pl
index de433d3..4f4cfc4 100755
--- a/bin/bwa_aln.pl
+++ b/bin/bwa_aln.pl
@@ -229,7 +229,7 @@ =head2 INPUT FILE TYPES
 =item f[ast]q
 
 A standard uncompressed fastq file.  Requires a pair of inputs with standard suffix of '_1' and '_2'
-immediately prior to '.f[ast]q'.
+or 'R1_001' and 'R2_001' immediately prior to '.f[ast]q'.
 
 
 =item f[ast]q.gz
diff --git a/bin/bwa_mem.pl b/bin/bwa_mem.pl
index 0bab214..eb7b76c 100755
--- a/bin/bwa_mem.pl
+++ b/bin/bwa_mem.pl
@@ -462,8 +462,8 @@ =head2 INPUT FILE TYPES
 =item f[ast]q
 
 A standard uncompressed fastq file.  Requires a pair of inputs with standard suffix of '_1' and '_2'
-immediately prior to '.f[ast]q' or an interleaved f[ast]q file where read 1 and 2 are adjacent
-in the file.
+or 'R1_001' and 'R2_001' immediately prior to '.f[ast]q' or an interleaved f[ast]q file where read 1
+and 2 are adjacent in the file.
 
 
 =item f[ast]q.gz
diff --git a/lib/PCAP.pm b/lib/PCAP.pm
index bac4a3e..d53ebb0 100644
--- a/lib/PCAP.pm
+++ b/lib/PCAP.pm
@@ -28,7 +28,7 @@ use FindBin qw($Bin);
 use File::Which qw(which);
 # don't use autodie, only core perl in here
 
-our $VERSION = '5.2.2';
+our $VERSION = '5.3.0';
 our @EXPORT = qw($VERSION _which);
 
 const my $LICENSE =>
diff --git a/lib/PCAP/Bwa.pm b/lib/PCAP/Bwa.pm
index b275661..14dbf44 100644
--- a/lib/PCAP/Bwa.pm
+++ b/lib/PCAP/Bwa.pm
@@ -175,8 +175,8 @@ sub split_in {
     if($input->fastq) {
       # paired fq input
       if($input->paired_fq) {
-        my $fq1 = $input->in.'_1.'.$input->fastq;
-        my $fq2 = $input->in.'_2.'.$input->fastq;
+        my $fq1 = $input->in.($input->illumina_fq ? '_R1_001.' : '_1.').$input->fastq;
+        my $fq2 = $input->in.($input->illumina_fq ? '_R2_001.' : '_2.').$input->fastq;
         if($input->fastq =~ m/[.]gz$/ || $fragment_size > 5000) {
           symlink $fq1, File::Spec->catfile($split_folder, 'pairedfq1.0.'.$input->fastq);
           symlink $fq2, File::Spec->catfile($split_folder, 'pairedfq2.0.'.$input->fastq);
@@ -415,6 +415,7 @@ sub sampe {
 
   my $pathstub = $input_meta->[$index-1]->tstub;
   my $fastq = $input_meta->[$index-1]->fastq;
+  my $illumina_fq = $input_meta->[$index-1]->illumina_fq;
 
 
   my $command = _which('bwa') || die "Unable to find 'bwa' in path";;
@@ -425,10 +426,10 @@ sub sampe {
   if(defined $fastq) {
     $command .= sprintf $ALN_TO_SORTED, $input_meta->[$index-1]->rg_header(q{\t}),
                                       $ref,
-                                      $pathstub,
-                                      $pathstub,
-                                      $input_meta->[$index-1]->in.'_1', $fastq,
-                                      $input_meta->[$index-1]->in.'_2', $fastq,
+                                      $pathstub.($illumina_fq ? '_R1_001' : '_1'),
+                                      $pathstub.($illumina_fq ? '_R2_001' : '_2'),
+                                      $input_meta->[$index-1]->in.($illumina_fq ? '_R1_001' : '_1'), $fastq,
+                                      $input_meta->[$index-1]->in.($illumina_fq ? '_R2_001' : '_2'), $fastq,
                                       $bamsort,
                                       $pathstub,
                                       $pathstub;
@@ -436,8 +437,8 @@ sub sampe {
   else {
     $command .= sprintf $ALN_TO_SORTED, $input_meta->[$index-1]->rg_header(q{\t}),
                                       $ref,
-                                      $pathstub,
-                                      $pathstub,
+                                      $pathstub.'_1',
+                                      $pathstub.'_2',
                                       $pathstub, 'bam',
                                       $pathstub, 'bam',
                                       $bamsort,
diff --git a/lib/PCAP/Bwa/Meta.pm b/lib/PCAP/Bwa/Meta.pm
index 61fc16d..8257567 100644
--- a/lib/PCAP/Bwa/Meta.pm
+++ b/lib/PCAP/Bwa/Meta.pm
@@ -37,7 +37,7 @@ use YAML qw(LoadFile);
 
 use PCAP::Bam;
 
-const my @INIT_KEYS => qw(in temp fastq paired_fq cram bam);
+const my @INIT_KEYS => qw(in temp fastq paired_fq illumina_fq cram bam);
 const my @REQUIRED_KEYS => qw(in temp);
 const my @REQUIRED_RG_ELEMENTS => qw(SM);
 const my @ALLOWED_RG_ELEMENTS => qw(ID CN DS DT FO KS LB PG PI PL PM PU SM);
@@ -98,6 +98,12 @@ sub paired_fq {
   return $self->{'paired_fq'}; # this will create a key but not worth adding overhead to prevent
 }
 
+sub illumina_fq {
+  my $self = shift;
+  croak "'illumina_fq' can only be set via new()" if(scalar @_ > 0);
+  return $self->{'illumina_fq'};
+}
+
 sub bam_or_cram {
   my $self = shift;
   if(exists $self->{'bam'} && defined $self->{'bam'} && $self->{'bam'} == 1) {
@@ -271,10 +277,11 @@ sub files_to_meta {
         # must be paired fq
         next if(exists $seen_paired_stub{$fq_stub});
         $seen_paired_stub{$fq_stub} = 1;
-        die "Unable to find file for read 1, for ${fq_stub}_X.${fq_ext}\n" unless(-e "${fq_stub}_1.$fq_ext");
-        die "Unable to find file for read 2, for ${fq_stub}_X.${fq_ext}\n" unless(-e "${fq_stub}_2.$fq_ext");
-        die "File for read 1 is empty: ${fq_stub}_X.${fq_ext}\n" unless(-s "${fq_stub}_1.$fq_ext");
-        die "File for read 2 is empty: ${fq_stub}_X.${fq_ext}\n" unless(-s "${fq_stub}_2.$fq_ext");
+        die "Unable to find file for read 1, for ${fq_stub}_X.${fq_ext}\n" unless(-e "${fq_stub}_1.$fq_ext" || -e "${fq_stub}_R1_001.$fq_ext");
+        die "Unable to find file for read 2, for ${fq_stub}_X.${fq_ext}\n" unless(-e "${fq_stub}_2.$fq_ext" || -e "${fq_stub}_R2_001.$fq_ext");
+        die "File for read 1 is empty: ${fq_stub}_X.${fq_ext}\n" unless(-s "${fq_stub}_1.$fq_ext" || -s "${fq_stub}_R1_001.$fq_ext");
+        die "File for read 2 is empty: ${fq_stub}_X.${fq_ext}\n" unless(-s "${fq_stub}_2.$fq_ext" || -s "${fq_stub}_R2_001.$fq_ext");
+        $meta->{'illumina_fq'} = ( $end=~m/R[12]_001/ ? 1 : 0 );
         $meta->{'paired_fq'} = 1;
         $are_paired_fq = 1;
       }
@@ -343,7 +350,7 @@ sub is_fastq_ext {
 sub parse_fastq_filename {
   my $fastq = shift; # shouldn't have extension by now
   my $end;
-  if($fastq =~ s/_([12])$//) {
+  if($fastq =~ s/_([12]|R[12]_001)$//) {
     $end = $1;
   }
   return ($fastq, $end);
@@ -419,9 +426,9 @@ Added for future compatibility with files that can be used with 'BWA mem'.
 
 When input is some form of fastq this returns the extension, otherwise undef.
 
-=item paired_fq
+=item illumina_fq
 
-When input is a paired fastq file this returns true.
+If paired FASTQ names end with _R[12]_001, this returns true. Returns false if they end with _[12].
 
 =item rg
 
@@ -488,6 +495,9 @@ Understands the following as fastq files:
 Takes a fastq filename after removal of the extension (see L<is_fastq_ext()/PCAP::Bwa::Meta/is_fastq_ext>
 and determines if file is read1, read2 or interleaved fastq.
 
-Expects file to end '_1' or '_2' for paired, assumed interleaved otherwise.
+Expects paired FASTQ names to end with one the following. Assumes interleaved FASTQ otherwise.
+
+  _1 and _2 - PCAP's original naming requirement
+  _R1_001 and _R2_001 - Illumina's naming requirement; Require 3 digit suffix to be 001 to avoid split FASTQs
 
 =back
diff --git a/t/data/4_R1_001.fq b/t/data/4_R1_001.fq
new file mode 100644
index 0000000..54b00f5
--- /dev/null
+++ b/t/data/4_R1_001.fq
@@ -0,0 +1,4 @@
+@HS1_10761:8:1312:1589:61870#79/1
+CTAACCCTAACCCTAACCCTAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTAAC
++
+ECEFEGFFDBHHEFCHFGGGGHHHFFGGGGGGDHIDGFFFEGEFH;FGECGGHGDHHAEEEBH:FADEIEEFAED
diff --git a/t/data/4_R2_001.fq b/t/data/4_R2_001.fq
new file mode 100644
index 0000000..b06c448
--- /dev/null
+++ b/t/data/4_R2_001.fq
@@ -0,0 +1,4 @@
+@HS1_10761:8:1312:1589:61870#79/2
+GGGTTAGGGTTAGGGTTAAGGGTTAGGGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTTAG
++
+>:B>EFFFC7FCHGF5HDHGFH5G4HFC4GFGGF(FFDHB>BFHCF3EEGE?3EGHEE333@GH*CBG;=(ABDC
diff --git a/t/pcapBwaMeta.t b/t/pcapBwaMeta.t
index 69a19cb..33ea38e 100644
--- a/t/pcapBwaMeta.t
+++ b/t/pcapBwaMeta.t
@@ -73,6 +73,12 @@ subtest 'Non-object funcions' => sub {
     ($base, $end) = PCAP::Bwa::Meta::parse_fastq_filename('fastq_2');
     is($base, 'fastq', "fastq_2 file should have '_2' removed");
     is($end, '2', "Read end should be 2");
+    ($base, $end) = PCAP::Bwa::Meta::parse_fastq_filename('fastq_R1_001');
+    is($base, 'fastq', "fastq_R1_001 has a basename of 'fastq'");
+    is($end, 'R1_001', "file ending with R1_001 indicates read 1 of pair");
+    ($base, $end) = PCAP::Bwa::Meta::parse_fastq_filename('fastq_R2_001');
+    is($base, 'fastq', "fastq_R2_001 has a basename of 'fastq'");
+    is($end, 'R2_001', "file ending with R2_001 indicates read 2 of a pair");
     ($base, $end) = PCAP::Bwa::Meta::parse_fastq_filename('fastq_3');
     isnt($base, 'fastq', "fastq_3 file should be unchanged, assume interleaved");
     ok(!defined $end, "_3, so not defined");
@@ -134,6 +140,9 @@ subtest 'Objects from file list' => sub {
   is(PCAP::Bwa::Meta::files_to_meta($tmp, [ File::Spec->catfile($test_data, '1_1.fq')
                                           , File::Spec->catfile($test_data, '1_2.fq')], 'sample')->[0]->{'paired_fq'}
     , 1, 'Paired fq identified as paired');
+  is(PCAP::Bwa::Meta::files_to_meta($tmp, [ File::Spec->catfile($test_data, '4_R1_001.fq')
+                                          , File::Spec->catfile($test_data, '4_R2_001.fq')], 'sample')->[0]->{'paired_fq'}
+    , 1, 'Paired fastqs with Illumina names identified as paired');
   like( exception{ PCAP::Bwa::Meta::files_to_meta($tmp
                                                   , [ File::Spec->catfile($test_data, '2_1.fq')
                                                     , File::Spec->catfile($test_data, '2_2.fq')]
@@ -173,6 +182,13 @@ subtest 'Objects from file list' => sub {
                                                       , 'sample') }
       , qq{ERROR: BAM|CRAM, paired FASTQ and interleaved FASTQ file types cannot be mixed, please choose one type\n}
       , 'Fail when inputs are mixed file types');
+  is( exception{ PCAP::Bwa::Meta::files_to_meta($tmp
+                                                    , [ File::Spec->catfile($test_data, '4_R1_001.fq')
+                                                      , File::Spec->catfile($test_data, '4_R2_001.fq')
+                                                      , File::Spec->catfile($test_data, '1.fq')]
+                                                      , 'sample') }
+      , qq{ERROR: BAM|CRAM, paired FASTQ and interleaved FASTQ file types cannot be mixed, please choose one type\n}
+      , 'Fail when inputs mix interleaves with paired per illumina');
   like( exception{ PCAP::Bwa::Meta::files_to_meta($tmp, [ File::Spec->catfile($test_data, 'wibble.wobble')]
                                                       , 'sample') }
       , qr/.+ is not an expected input file type.\n/m
@@ -248,6 +264,11 @@ subtest 'Accessors' => sub {
       , qr/'paired_fq' can only be set via new\(\)/
       , 'Fail to directly set paired_fq');
 
+  is($meta->illumina_fq, 0, 'Expected non illumina fastq names');
+  like( exception { $meta->illumina_fq(1) }
+      , qr/'illumina_fq' can only be set via new\(\)/
+      , 'Fail to directly set illumina_fq');
+
   my $tstub = File::Spec->catfile($tmp, '2'); # 2 as files_to_meta called twice
 
   is($meta->tstub, $tstub, 'Generate expected tstub');