Python Module Usage

OSTIR can be called from within a Python script via the run_ostir() function. This function returns a list of dictionaries containing the translation initiation rates (expression levels) predicted for start codons in the sequence.

Example usage:

from ostir.ostir import run_ostir

seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU"

results = run_ostir(seq, name="my_sequence", aSD="ACCTCCTTA", threads=8)
print(results)

results = run_ostir(seq, start=31, end=31, aSD="ACCCCCTTA", verbose=True)
print(results)

Parameters:

• seq: mRNA sequence to search for translation initiation sites. (REQUIRED)
• start: Most 5' position to consider a start codon beginning. (1-indexed) Defaults to first base. (OPTIONAL)
• end: Most 3' position to consider a start codon beginning. (1-indexed) Defaults to last base. (OPTIONAL)
• name: Name or id of the sequence to include in output. Defaults to 'unnamed'. (OPTIONAL)
• aSD: anti-Shine-Dalgarno sequence. Defaults to that of E. coli. (OPTIONAL)
• threads: Number of parallel processes to launch during prediction. Defaults to 1. (OPTIONAL)
• verbose: Prints debug information. Defaults to False. (OPTIONAL)

Return value:

A list of predictions, each of which is a dictionary that contains the output columns described on the Command Line Usage page.