Added README

Author: MasterGreenyMC

README.md

@@ -0,0 +1,88 @@
+# BioAlign - DNA Sequence Alignment Tool
+
+BioAlign is a user-friendly tool for DNA sequence alignment and visualization. It uses Clustal Omega for alignment and creates nicely formatted Word documents with customizable sequence highlighting.
+
+## Features
+
+- Automatic DNA sequence alignment using Clustal Omega
+- Triplet notation formatting for better readability
+- Search and highlight specific DNA sequences in the alignment
+- Option for spaced or exact sequence matching
+- Different highlight colors for each sequence (optional)
+- Caching of alignment results for unchanged sequences
+
+## Installation
+
+No installation required! The release zip file contains everything you need:
+
+1. Unzip the file to any location on your computer
+2. Run `start.bat` to launch the application
+
+The package includes:
+- Embedded Python 3.13.2 runtime
+- Clustal Omega 1.2.2 executable
+- All required Python dependencies
+
+## Usage
+
+### Preparing Your Sequences
+
+Create or edit the `sequences.json` file in the application folder. This file should contain your DNA sequences in the following format:
+
+```json
+{
+  "Sequence1": "ATGCCTGACCTAGTCGATCGATGCTA",
+  "Sequence2": "ATGCGTGACCTAGTTGATCGATGCTA",
+  "Sequence3": "ATGCCTGACCAAGTCGATCTATGCTA"
+}
+```
+
+Where:
+- Each key is the sequence name
+- Each value is the DNA sequence
+- You can add as many sequences as needed
+
+### Running the Application
+
+1. Double-click the `start.bat` file
+2. The program will:
+   - Load your sequences from sequences.json
+   - Perform sequence alignment (or use cached results if unchanged)
+   - Prompt you for search options
+
+### Search Options
+
+When prompted:
+
+1. Enter a DNA sequence to search for (e.g., "CTG") or leave empty to disable highlighting
+2. Choose search mode:
+   - `exact`: Matches only exact sequences without spaces
+   - `spaced`: Matches sequences allowing for spaces between nucleotides
+3. Choose whether to use separate colors for each sequence (yes/no)
+
+### Output
+
+The program generates:
+- `sequences.fasta`: The input file for Clustal Omega
+- `sequences.aln`: The alignment result from Clustal Omega
+- `sequences.docx`: The final Word document with formatted alignment and highlighting
+
+## Example
+
+For the provided example sequences, searching for "CTG" with spaced mode enabled will highlight this pattern in all sequences, allowing you to easily compare variations.
+
+## Notes
+
+- The tool caches alignment results to avoid redundant calculations
+- The Word document uses Courier New font for consistent spacing
+- Highlighting uses yellow by default, or green/blue/pink when using separate colors
+
+## Requirements
+
+This package is self-contained and works on Windows systems without additional installations.
+
+## Acknowledgements
+
+- [Clustal Omega](http://www.clustal.org/omega/) for sequence alignment
+- [Biopython](https://biopython.org/) for biological sequence handling
+- [python-docx](https://python-docx.readthedocs.io/) for Word document generation